Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog RbsR - Thermoanaerobacterales

Properties
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Ribose utilization
Effector: Ribose
Phylum: Firmicutes
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 4 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Anaerocellum thermophilum DSM 6725
Caldicellulosiruptor saccharolyticus DSM 8903
Carboxydothermus hydrogenoformans Z-2901
Moorella thermoacetica ATCC 39073
Thermoanaerobacter ethanolicus X514 6 1
Thermoanaerobacter italicus Ab9
Thermoanaerobacter tengcongensis MB4 6 1
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
rbsR
 
Anaerocellum thermophilum DSM 6725
 
Caldicellulosiruptor saccharolyticus DSM 8903
 
Carboxydothermus hydrogenoformans Z-2901
 
Moorella thermoacetica ATCC 39073
*
Thermoanaerobacter ethanolicus X514

Site:
position = -53
score = 6.39561
sequence = ATAGTTAAGCGTTTTACTAA

Site:
position = -40
score = 5.99899
sequence = TTACTAAAACGTTAAACCAA

Gene: Teth514_0161: Transcriptional repressor of ribose utilization, LacI famil
 
Thermoanaerobacter italicus Ab9
*
Thermoanaerobacter tengcongensis MB4

Site:
position = -53
score = 6.39561
sequence = ATAGTTAAGCGTTTTACTAA

Site:
position = -40
score = 6.21713
sequence = TTACTAAAACGTTAAACTAT

Gene: TTE0201: Transcriptional repressor of ribose utilization, LacI famil
Transcriptional repressor of ribose utilization, LacI famil
rbsK
 
Anaerocellum thermophilum DSM 6725
 
Caldicellulosiruptor saccharolyticus DSM 8903
 
Carboxydothermus hydrogenoformans Z-2901
 
Moorella thermoacetica ATCC 39073
 
Thermoanaerobacter ethanolicus X514

Gene: Teth514_0162: Ribokinase (EC 2.7.1.15)
 
Thermoanaerobacter italicus Ab9
 
Thermoanaerobacter tengcongensis MB4

Gene: TTE0202: Ribokinase (EC 2.7.1.15)
Ribokinase (EC 2.7.1.15)
rbsD
 
Anaerocellum thermophilum DSM 6725
 
Caldicellulosiruptor saccharolyticus DSM 8903
 
Carboxydothermus hydrogenoformans Z-2901
 
Moorella thermoacetica ATCC 39073
 
Thermoanaerobacter ethanolicus X514

Gene: Teth514_0163: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)
 
Thermoanaerobacter italicus Ab9
 
Thermoanaerobacter tengcongensis MB4

Gene: TTE0203: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)
D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)
rbsA
 
Anaerocellum thermophilum DSM 6725
 
Caldicellulosiruptor saccharolyticus DSM 8903
 
Carboxydothermus hydrogenoformans Z-2901
 
Moorella thermoacetica ATCC 39073
 
Thermoanaerobacter ethanolicus X514

Gene: Teth514_0164: Ribose ABC transporter, ATP-binding protein (TC 3.A.1.2.1)
 
Thermoanaerobacter italicus Ab9
 
Thermoanaerobacter tengcongensis MB4

Gene: TTE0204: Ribose ABC transporter, ATP-binding protein (TC 3.A.1.2.1)
Ribose ABC transporter, ATP-binding protein (TC 3.A.1.2.1)
rbsC
 
Anaerocellum thermophilum DSM 6725
 
Caldicellulosiruptor saccharolyticus DSM 8903
 
Carboxydothermus hydrogenoformans Z-2901
 
Moorella thermoacetica ATCC 39073
 
Thermoanaerobacter ethanolicus X514

Gene: Teth514_0165: Ribose ABC transporter, permease protein 2 (TC 3.A.1.2.1)
 
Thermoanaerobacter italicus Ab9
 
Thermoanaerobacter tengcongensis MB4

Gene: TTE0205: Ribose ABC transporter, permease protein 2 (TC 3.A.1.2.1)
Ribose ABC transporter, permease protein 2 (TC 3.A.1.2.1)
rbsB
 
Anaerocellum thermophilum DSM 6725
 
Caldicellulosiruptor saccharolyticus DSM 8903
 
Carboxydothermus hydrogenoformans Z-2901
 
Moorella thermoacetica ATCC 39073
 
Thermoanaerobacter ethanolicus X514

Gene: Teth514_0166: Ribose ABC transporter, substrate-binding protein (TC 3.A.1.2.1)
 
Thermoanaerobacter italicus Ab9
 
Thermoanaerobacter tengcongensis MB4

Gene: TTE0206: Ribose ABC transporter, substrate-binding protein (TC 3.A.1.2.1)
Ribose ABC transporter, substrate-binding protein (TC 3.A.1.2.1)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD