Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog MalR - Xanthomonadales

Properties
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Maltodextrin utilization; Maltose utilization
Effector: Maltose
Phylum: Proteobacteria/gamma
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 14 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Stenotrophomonas maltophilia K279a 6 4
Xanthomonas axonopodis pv. citri str. 306 7 5
Xanthomonas campestris pv. campestris str. ATCC 33913 7 5
Xylella fastidiosa 9a5c
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
susB
*
Stenotrophomonas maltophilia K279a

Site:
position = -90
score = 5.8648
sequence = AGCTGCATACGTATTCATGG

Gene: Smlt1176: Alpha-glucosidase (EC 3.2.1.20)
*
Xanthomonas axonopodis pv. citri str. 306

Site:
position = -104
score = 6.3734
sequence = CACTGCATACGTATTCATGG

Gene: XAC2599: Alpha-glucosidase (EC 3.2.1.20)
*
Xanthomonas campestris pv. campestris str. ATCC 33913

Site:
position = -103
score = 6.3734
sequence = CCCTGCATACGTATTCATGG

Gene: XCC2468: Alpha-glucosidase (EC 3.2.1.20)
 
Xylella fastidiosa 9a5c
Alpha-glucosidase (EC 3.2.1.20)
 
CRON 2.
malZ
*
Stenotrophomonas maltophilia K279a

Site:
position = -91
score = 6.40075
sequence = GCGTGAATACGTATGCAGGT

Gene: Smlt1174: Maltodextrin glucosidase (EC 3.2.1.20)
*
Xanthomonas axonopodis pv. citri str. 306

Site:
position = -107
score = 6.73718
sequence = CAATGAATACGTATGCACGT

Gene: XAC2602: Maltodextrin glucosidase (EC 3.2.1.20)
*
Xanthomonas campestris pv. campestris str. ATCC 33913

Site:
position = -107
score = 6.66446
sequence = CTATGAATACGTATGCACGG

Gene: XCC2471: Maltodextrin glucosidase (EC 3.2.1.20)
 
Xylella fastidiosa 9a5c
Maltodextrin glucosidase (EC 3.2.1.20)
 
CRON 3.
amy
 
Stenotrophomonas maltophilia K279a
*
Xanthomonas axonopodis pv. citri str. 306

Site:
position = -163
score = 6.32868
sequence = CAGTGAATACGTATGCACAA

Gene: XAC0798: Alpha-amylase EC=3.2.1.1
*
Xanthomonas campestris pv. campestris str. ATCC 33913

Site:
position = -164
score = 6.64051
sequence = CAGTGAATACGTATGCACAG

Gene: XCC0748: Alpha-amylase EC=3.2.1.1
 
Xylella fastidiosa 9a5c
Alpha-amylase EC=3.2.1.1
 
CRON 4.
omp(Mal)
*
Stenotrophomonas maltophilia K279a

Site:
position = -12
score = 6.73092
sequence = CATTGAATACGTATGCAGGG

Gene: Smlt1175: Predicted maltose-specific outer membrane transporter, TonB-dependent
*
Xanthomonas axonopodis pv. citri str. 306

Site:
position = -88
score = 6.70696
sequence = CAGTGAATACGTATGCAGTG

Gene: XAC2600: Predicted maltose-specific outer membrane transporter, TonB-dependent
*
Xanthomonas campestris pv. campestris str. ATCC 33913

Site:
position = -94
score = 6.27713
sequence = CGTTGAATACGTATGCAGGC

Gene: XCC2469: Predicted maltose-specific outer membrane transporter, TonB-dependent
 
Xylella fastidiosa 9a5c
Predicted maltose-specific outer membrane transporter, TonB-dependent
 
CRON 5.
COG3408
*
Stenotrophomonas maltophilia K279a

Site:
position = -101
score = 6.4918
sequence = CCATGAATACGTATGCAGCT

Gene: Smlt1177: Glycogen debranching enzyme
*
Xanthomonas axonopodis pv. citri str. 306

Site:
position = -158
score = 6.7432
sequence = CCATGAATACGTATGCAGTG

Gene: XAC2598: Glycogen debranching enzyme
*
Xanthomonas campestris pv. campestris str. ATCC 33913

Site:
position = -159
score = 6.96395
sequence = CCATGAATACGTATGCAGGG

Gene: XCC2467: Glycogen debranching enzyme
 
Xylella fastidiosa 9a5c
Glycogen debranching enzyme
malT
 
Stenotrophomonas maltophilia K279a

Gene: Smlt1178: Predicted maltose transporter MalT
 
Xanthomonas axonopodis pv. citri str. 306

Gene: XAC2597: Predicted maltose transporter MalT
 
Xanthomonas campestris pv. campestris str. ATCC 33913

Gene: XCC2466: Predicted maltose transporter MalT
 
Xylella fastidiosa 9a5c
Predicted maltose transporter MalT
cgt
 
Stenotrophomonas maltophilia K279a

Gene: Smlt1179: Cyclomaltodextrin glucanotransferase EC=2.4.1.19
 
Xanthomonas axonopodis pv. citri str. 306

Gene: XAC2596: Cyclomaltodextrin glucanotransferase EC=2.4.1.19
 
Xanthomonas campestris pv. campestris str. ATCC 33913

Gene: XCC2465: Cyclomaltodextrin glucanotransferase EC=2.4.1.19
 
Xylella fastidiosa 9a5c
Cyclomaltodextrin glucanotransferase EC=2.4.1.19
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD