Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog PdxR3 - Nocardiaceae

Properties
Regulator type: Transcription factor
Regulator family: GntR/MocR
Regulation mode:
Biological process: Pyridoxine/pyridoxal homeostasis
Effector:
Phylum: Actinobacteria
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 16 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Nocardia farcinica IFM 10152 2 2
Rhodococcus erythropolis PR4 2 2
Rhodococcus opacus B4 4 4
Rhodococcus sp. RHA1 3 3
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
COG2364
 
Nocardia farcinica IFM 10152
*
Rhodococcus erythropolis PR4

Site:
position = -93
score = 3.32446
sequence = ATGCGGGCTTCACGGAAGTGGCAC

Site:
position = -23
score = 4.66536
sequence = AGTCCAGTATCGACAACTTGGCTA

Gene: RER_23600: Predicted membrane protein
*
Rhodococcus opacus B4

Site:
position = -160
score = 3.61312
sequence = GGTCCAGTAACGCCGACATGGCTA

Site:
position = -238
score = 3.483
sequence = ACGCCGGCTTCACGGAGGTGGCAC

Gene: ROP_65020: Predicted membrane protein
*
Rhodococcus sp. RHA1

Site:
position = -6
score = 3.92362
sequence = GGTCCAGTGCCTGCGTGGTGGCTA

Site:
position = -78
score = 3.65262
sequence = ACGCCGGTTTCACCGAGGTGGCTC

Gene: RHA1_ro06449: Predicted membrane protein
Predicted membrane protein
 
CRON 2.
pdxR3
*
Nocardia farcinica IFM 10152

Site:
position = -26
score = 4.91021
sequence = TAGCCAATCCGCGAATACTGGACT

Gene: nfa53660: Transcriptional regulator, GntR/MocR family
*
Rhodococcus erythropolis PR4

Site:
position = -26
score = 4.66536
sequence = TAGCCAAGTTGTCGATACTGGACT

Gene: RER_14310: Transcriptional regulator, GntR/MocR family
*2
Rhodococcus opacus B4

Site:
position = -239
score = 3.96268
sequence = GGTCCAGTCCGGATCTTCTGGACT

Site:
position = -29
score = 4.12566
sequence = TAGCCAAGGGGGTGATACTGGACT

Gene: ROP_56250: Transcriptional regulator, GntR/MocR family

Site:
position = -200
score = 3.15553
sequence = CGGCCAGCCGTTGTATCGCGGGCT

Gene: ROP_64330: Transcriptional regulator, GntR/MocR family
*2
Rhodococcus sp. RHA1

Site:
position = -236
score = 3.80113
sequence = AGGCCAGTGCGGATCTTCTGGACT

Site:
position = -26
score = 3.94143
sequence = TAGCCAAGAGGTTGATACTGGACT

Gene: RHA1_ro05556: Transcriptional regulator, GntR/MocR family

Site:
position = -26
score = 3.48661
sequence = CAGTCCTCTGTGGAAAAGTGGCCT

Gene: RHA1_ro06371: Transcriptional regulator, GntR/MocR family
Transcriptional regulator, GntR/MocR family
 
CRON 3.
COG0350
*
Nocardia farcinica IFM 10152

Site:
position = -67
score = 5.68084
sequence = AGTCCAGTTTCGAAAAACTGGACT

Gene: nfa53680: Methylated DNA-protein cysteine methyltransferase
 
Rhodococcus erythropolis PR4
*
Rhodococcus opacus B4

Site:
position = -137
score = 3.96268
sequence = AGTCCAGAAGATCCGGACTGGACC

Gene: ROP_56230: Methylated DNA-protein cysteine methyltransferase
 
Rhodococcus sp. RHA1

Gene: RHA1_ro05553: Methylated DNA-protein cysteine methyltransferase
Methylated DNA-protein cysteine methyltransferase
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD