Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog Phr - Methanomicrobiales

Properties
Regulator type: Transcription factor
Regulator family: ArsR
Regulation mode: repressor
Biological process: Heat shock response
Effector:
Phylum: Euryarchaeota
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 11 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Candidatus Methanoregula boonei 6A8 8 2
Candidatus Methanosphaerula palustris E1-9c 3 2
Methanocorpusculum labreanum Z 2 2
Methanoculleus marisnigri JR1 3 2
Methanospirillum hungatei JF-1 5 2
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
Mboo_1603
*
Candidatus Methanoregula boonei 6A8

Site:
position = -167
score = 4.2996
sequence = CGCACTAAAACATTGTTAGTTAT

Site:
position = -43
score = 4.85118
sequence = CAGACTAACTAATGGTTAATCCT

Gene: Mboo_1603: Hypothetical protein
 
Candidatus Methanosphaerula palustris E1-9c
 
Methanocorpusculum labreanum Z
 
Methanoculleus marisnigri JR1
 
Methanospirillum hungatei JF-1
Hypothetical protein
clpB
 
Candidatus Methanoregula boonei 6A8

Gene: Mboo_1604: ATPase AAA-2 domain protein
 
Candidatus Methanosphaerula palustris E1-9c
 
Methanocorpusculum labreanum Z
 
Methanoculleus marisnigri JR1
 
Methanospirillum hungatei JF-1

Gene: Mhun_1289: ATPase AAA-2 domain protein
ATPase AAA-2 domain protein
grpE
 2
Candidatus Methanoregula boonei 6A8

Gene: Mboo_1206: Heat shock protein GrpE

Gene: Mboo_1605: Heat shock protein GrpE
 2
Candidatus Methanosphaerula palustris E1-9c

Gene: Mpal_1614: Heat shock protein GrpE

Gene: Mpal_2350: Heat shock protein GrpE
 
Methanocorpusculum labreanum Z

Gene: Mlab_0944: Heat shock protein GrpE
 
Methanoculleus marisnigri JR1

Gene: Memar_1062: Heat shock protein GrpE
*
Methanospirillum hungatei JF-1

Site:
position = -182
score = 5.01997
sequence = TACACTAACTTCAAGTAAATACT

Gene: Mhun_0129: Heat shock protein GrpE
Heat shock protein GrpE
dnaK
 2
Candidatus Methanoregula boonei 6A8

Gene: Mboo_1207: Chaperone protein DnaK

Gene: Mboo_1606: Chaperone protein DnaK
 2
Candidatus Methanosphaerula palustris E1-9c

Gene: Mpal_1615: Chaperone protein DnaK

Gene: Mpal_2349: Chaperone protein DnaK
 
Methanocorpusculum labreanum Z

Gene: Mlab_0943: Chaperone protein DnaK
 
Methanoculleus marisnigri JR1

Gene: Memar_1061: Chaperone protein DnaK
 
Methanospirillum hungatei JF-1

Gene: Mhun_0128: Chaperone protein DnaK
Chaperone protein DnaK
dnaJ
 2
Candidatus Methanoregula boonei 6A8

Gene: Mboo_1607: Chaperone protein DnaJ

Gene: Mboo_1208: Chaperone protein DnaJ
 2
Candidatus Methanosphaerula palustris E1-9c

Gene: Mpal_1616: Chaperone protein DnaJ

Gene: Mpal_2348: Chaperone protein DnaJ
 
Methanocorpusculum labreanum Z

Gene: Mlab_0942: Chaperone protein DnaJ
 
Methanoculleus marisnigri JR1

Gene: Memar_1060: Chaperone protein DnaJ
 
Methanospirillum hungatei JF-1

Gene: Mhun_0127: Chaperone protein DnaJ
Chaperone protein DnaJ
hsp20-1
 
Candidatus Methanoregula boonei 6A8

Gene: Mboo_1608: Small heat shock protein 20
*
Candidatus Methanosphaerula palustris E1-9c

Site:
position = -69
score = 5.06234
sequence = ACCACTTACTTTTGGTTAGTTCA

Gene: Mpal_0298: Small heat shock protein 20
*
Methanocorpusculum labreanum Z

Site:
position = -55
score = 5.2372
sequence = GTGACTTACTATTAGTAAATCAC

Gene: Mlab_1294: Small heat shock protein 20
*3
Methanoculleus marisnigri JR1

Gene: Memar_1758: Small heat shock protein 20

Site:
position = -71
score = 4.95617
sequence = GACACTACCTTAAGGTTAGCCTC

Gene: Memar_1986: Small heat shock protein 20

Gene: Memar_1494: Small heat shock protein 20
 
Methanospirillum hungatei JF-1

Gene: Mhun_0154: Small heat shock protein 20
Small heat shock protein 20
 
CRON 2.
phr
*
Candidatus Methanoregula boonei 6A8

Site:
position = -20
score = 5.38356
sequence = AACACTAACATAAAGTAAACATG

Gene: Mboo_1711: Heat shock response regulator Phr, ArsR family
*
Candidatus Methanosphaerula palustris E1-9c

Site:
position = -21
score = 5.42191
sequence = CTCCCTAACATAAAGTAAATAAT

Gene: Mpal_2059: Heat shock response regulator Phr, ArsR family
*
Methanocorpusculum labreanum Z

Site:
position = -28
score = 4.30366
sequence = TCCCCTTACATAATGTAATCTCG

Gene: Mlab_1236: Heat shock response regulator Phr, ArsR family
*
Methanoculleus marisnigri JR1

Site:
position = -20
score = 5.47818
sequence = ATCACTAACATTTAGTAAATATG

Gene: Memar_1567: Heat shock response regulator Phr, ArsR family
*
Methanospirillum hungatei JF-1

Site:
position = -21
score = 5.66575
sequence = TTCACTAACATAGAGTTAGTGAT

Gene: Mhun_2633: Heat shock response regulator Phr, ArsR family
Heat shock response regulator Phr, ArsR family
hsp20-2
 
Candidatus Methanoregula boonei 6A8

Gene: Mboo_1710: Small heat shock protein 20
 
Candidatus Methanosphaerula palustris E1-9c

Gene: Mpal_2058: Small heat shock protein 20
 
Methanocorpusculum labreanum Z
 
Methanoculleus marisnigri JR1

Gene: Memar_1566: Small heat shock protein 20
 
Methanospirillum hungatei JF-1

Gene: Mhun_2634: Small heat shock protein 20
Small heat shock protein 20
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD