Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog Phr - Methanobacteriales

Properties
Regulator type: Transcription factor
Regulator family: ArsR
Regulation mode: repressor
Biological process: Heat shock response
Effector:
Phylum: Euryarchaeota
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 14 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Methanobrevibacter ruminantium M1 3 2
Methanobrevibacter smithii ATCC 35061 4 2
Methanobrevibacter smithii DSM 2375 4 2
Methanosphaera stadtmanae DSM 3091 4 2
Methanothermobacter thermautotrophicus str. Delta H 4 2
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
grpE
*
Methanobrevibacter ruminantium M1

Site:
position = -448
score = 5.43247
sequence = TAAAATTACTTTTTGTAAGAAAA

Site:
position = -414
score = 6.42552
sequence = TTATATAACATTTTGTTACTAAA

Gene: mru_2038: Heat shock protein GrpE
*
Methanobrevibacter smithii ATCC 35061

Site:
position = -217
score = 6.20698
sequence = TTATATAACTTTTTGTTACTATA

Gene: Msm_1108: Heat shock protein GrpE
*
Methanobrevibacter smithii DSM 2375

Site:
position = -217
score = 6.20698
sequence = TTATATAACTTTTTGTTACTATA

Gene: METSMIALI_01035: Heat shock protein GrpE
*
Methanosphaera stadtmanae DSM 3091

Site:
position = -122
score = 6.04859
sequence = ATATATAACATTTTGTTACTAAA

Site:
position = -156
score = 6.25812
sequence = TTTTGTAACTAAAAGTTATTAAA

Gene: Msp_1518: Heat shock protein GrpE
*
Methanothermobacter thermautotrophicus str. Delta H

Site:
position = -88
score = 5.5898
sequence = TTATATAACCTTTTGTAAGTATA

Gene: MTH1289: Heat shock protein GrpE
Heat shock protein GrpE
dnaK
 
Methanobrevibacter ruminantium M1

Gene: mru_2039: Chaperone protein DnaK
 
Methanobrevibacter smithii ATCC 35061

Gene: Msm_1109: Chaperone protein DnaK
 
Methanobrevibacter smithii DSM 2375

Gene: METSMIALI_01036: Chaperone protein DnaK
 
Methanosphaera stadtmanae DSM 3091

Gene: Msp_1517: Chaperone protein DnaK
 
Methanothermobacter thermautotrophicus str. Delta H

Gene: MTH1290: Chaperone protein DnaK
Chaperone protein DnaK
dnaJ
 
Methanobrevibacter ruminantium M1

Gene: mru_2040: Chaperone protein DnaJ
 
Methanobrevibacter smithii ATCC 35061

Gene: Msm_1110: Chaperone protein DnaJ
 
Methanobrevibacter smithii DSM 2375

Gene: METSMIALI_01037: Chaperone protein DnaJ
 
Methanosphaera stadtmanae DSM 3091

Gene: Msp_1516: Chaperone protein DnaJ
 
Methanothermobacter thermautotrophicus str. Delta H

Gene: MTH1291: Chaperone protein DnaJ
Chaperone protein DnaJ
 
CRON 2.
phr
*
Methanobrevibacter ruminantium M1

Site:
position = -149
score = 5.81278
sequence = TTTAGTAACAAAAAGTTAATATA

Site:
position = -238
score = 6.42552
sequence = TTTAGTAACAAAATGTTATATAA

Gene: mru_2037: Heat shock response regulator Phr, ArsR family
*
Methanobrevibacter smithii ATCC 35061

Site:
position = -46
score = 6.20698
sequence = TATAGTAACAAAAAGTTATATAA

Gene: Msm_1107: Heat shock response regulator Phr, ArsR family
*
Methanobrevibacter smithii DSM 2375

Site:
position = -46
score = 6.20698
sequence = TATAGTAACAAAAAGTTATATAA

Gene: METSMIALI_01034: Heat shock response regulator Phr, ArsR family
*
Methanosphaera stadtmanae DSM 3091

Site:
position = -187
score = 6.04859
sequence = TTTAGTAACAAAATGTTATATAT

Site:
position = -153
score = 6.25812
sequence = TTTAATAACTTTTAGTTACAAAA

Gene: Msp_1519: Heat shock response regulator Phr, ArsR family
*
Methanothermobacter thermautotrophicus str. Delta H

Site:
position = -42
score = 5.5898
sequence = TATACTTACAAAAGGTTATATAA

Gene: MTH1288: Heat shock response regulator Phr, ArsR family
Heat shock response regulator Phr, ArsR family
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD