Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog Phr - Archaeoglobales

Properties
Regulator type: Transcription factor
Regulator family: ArsR
Regulation mode: repressor
Biological process: Heat shock response
Effector:
Phylum: Euryarchaeota
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 6 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Archaeoglobus fulgidus DSM 4304 4 2
Archaeoglobus profundus DSM 5631 4 2
Ferroglobus placidus DSM 10642 4 2
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
phr
*
Archaeoglobus fulgidus DSM 4304

Site:
position = -34
score = 6.31493
sequence = AAACCTAACATAAAGTTAGTAAC

Gene: AF1298: Heat shock response regulator Phr, ArsR family
*
Archaeoglobus profundus DSM 5631

Site:
position = -43
score = 6.51041
sequence = TTTACTAACCAAAAGTTAGTAAA

Gene: Arcpr_0812: Heat shock response regulator Phr, ArsR family
*
Ferroglobus placidus DSM 10642

Site:
position = -58
score = 6.34567
sequence = TTTACTAACACAAAGTTAGTAAC

Gene: Ferp_0217: Heat shock response regulator Phr, ArsR family
Heat shock response regulator Phr, ArsR family
vat
 
Archaeoglobus fulgidus DSM 4304

Gene: AF1297: ATPase, AAA+ family
 
Archaeoglobus profundus DSM 5631

Gene: Arcpr_0811: ATPase, AAA+ family
 
Ferroglobus placidus DSM 10642

Gene: Ferp_0216: ATPase, AAA+ family
ATPase, AAA+ family
hsp20-1
 
Archaeoglobus fulgidus DSM 4304

Gene: AF1296: Small heat shock protein 20
 
Archaeoglobus profundus DSM 5631

Gene: Arcpr_0810: Small heat shock protein 20
 
Ferroglobus placidus DSM 10642

Gene: Ferp_0215: Small heat shock protein 20
Small heat shock protein 20
 
CRON 2.
hsp20-2
*
Archaeoglobus fulgidus DSM 4304

Site:
position = -56
score = 6.03738
sequence = CTACCTAACATAAAGTTAGGTTA

Gene: AF1971: Small heat shock protein 20
*
Archaeoglobus profundus DSM 5631

Site:
position = -48
score = 6.20028
sequence = TTTACTAACTAAAGGTTAGTAGT

Gene: Arcpr_1089: Small heat shock protein 20
*
Ferroglobus placidus DSM 10642

Site:
position = -46
score = 6.577
sequence = AATCCTAACTTAAAGTTAGGATT

Gene: Ferp_0363: Small heat shock protein 20
Small heat shock protein 20
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD