Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog Phr - Thermococcales

Properties
Regulator type: Transcription factor
Regulator family: ArsR
Regulation mode: repressor
Biological process: Heat shock response
Effector:
Phylum: Euryarchaeota
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 87 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Pyrococcus abyssi GE5 11 9
Pyrococcus furiosus DSM 3638 17 14
Pyrococcus horikoshii OT3 11 9
Thermococcus gammatolerans EJ3 17 13
Thermococcus kodakaraensis KOD1 16 14
Thermococcus onnurineus NA1 11 8
Thermococcus sibiricus MM 739 13 10
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
pfdA
 
Pyrococcus abyssi GE5
 
Pyrococcus furiosus DSM 3638
 
Pyrococcus horikoshii OT3
*
Thermococcus gammatolerans EJ3

Site:
position = -25
score = 6.12821
sequence = TTTAAATACAAAAGGTAACTAAA

Gene: TGAM_1373: Prefoldin, alpha subunit
*
Thermococcus kodakaraensis KOD1

Site:
position = -59
score = 5.19327
sequence = TTTAAATACCAAAAGTTATTTTA

Site:
position = -43
score = 5.05798
sequence = TATTTTAACAATGGGTAAGAAAA

Gene: TK1121: Prefoldin, alpha subunit
 
Thermococcus onnurineus NA1
 
Thermococcus sibiricus MM 739
Prefoldin, alpha subunit
pfdB
 
Pyrococcus abyssi GE5
 
Pyrococcus furiosus DSM 3638
 
Pyrococcus horikoshii OT3
 
Thermococcus gammatolerans EJ3

Gene: TGAM_1374: Prefoldin, beta subunit
 
Thermococcus kodakaraensis KOD1

Gene: TK1122: Prefoldin, beta subunit
 
Thermococcus onnurineus NA1
 
Thermococcus sibiricus MM 739
Prefoldin, beta subunit
 
CRON 2.
cas2
 
Pyrococcus abyssi GE5
*
Pyrococcus furiosus DSM 3638

Site:
position = -164
score = 4.72132
sequence = TTTCGTAACAAGTAAATAGTAAA

Site:
position = -125
score = 5.0125
sequence = AATACTAACTTTGAGTTACTAAA

Gene: PF1117: CRISPR-associated protein Cas2
 
Pyrococcus horikoshii OT3

Gene: PH0173.1n: CRISPR-associated protein Cas2
 
Thermococcus gammatolerans EJ3

Gene: TGAM_1299: CRISPR-associated protein Cas2
*
Thermococcus kodakaraensis KOD1

Site:
position = -157
score = 4.99073
sequence = GATAGTAACCAAACGTTACTAAA

Gene: TK0445: CRISPR-associated protein Cas2
*
Thermococcus onnurineus NA1

Site:
position = -164
score = 5.24062
sequence = GATAATTACTTTATGTTACTAAA

Gene: TON_0320: CRISPR-associated protein Cas2
*
Thermococcus sibiricus MM 739

Site:
position = -120
score = 4.92257
sequence = TTTCAAAACCAAAAGTTAAAAAC

Gene: TSIB_1494: CRISPR-associated protein Cas2
CRISPR-associated protein Cas2
 
CRON 3.
PF1931
*
Pyrococcus abyssi GE5

Site:
position = -52
score = 5.13148
sequence = TATAGTATCATGAAGTTAGTAAA

Gene: PAB2180: RecA-superfamily ATPase
*
Pyrococcus furiosus DSM 3638

Site:
position = -54
score = 4.6303
sequence = TATAGTATATTGAAGTTAGTAAA

Gene: PF1931: RecA-superfamily ATPase
*
Pyrococcus horikoshii OT3

Site:
position = -37
score = 5.11261
sequence = TATAGTATCATGAAGTTAATAAA

Gene: PH0284: RecA-superfamily ATPase
*
Thermococcus gammatolerans EJ3

Site:
position = -36
score = 5.04386
sequence = AATGGTAACTAAAAGTTACTAAA

Gene: TGAM_0280: RecA-superfamily ATPase
 
Thermococcus kodakaraensis KOD1

Gene: TK1590: RecA-superfamily ATPase
*
Thermococcus onnurineus NA1

Site:
position = -37
score = 5.55184
sequence = ATTGGTAACAAAAGGTAACTAAA

Gene: TON_1740: RecA-superfamily ATPase
*
Thermococcus sibiricus MM 739

Site:
position = -83
score = 5.42485
sequence = TATACTACCAATTGGTAATTAAA

Gene: TSIB_1804: RecA-superfamily ATPase
RecA-superfamily ATPase
PF1932
 
Pyrococcus abyssi GE5

Gene: PAB2181: Conserved hypothetical protein
 
Pyrococcus furiosus DSM 3638

Gene: PF1932: Conserved hypothetical protein
 
Pyrococcus horikoshii OT3

Gene: PH0283: Conserved hypothetical protein
 
Thermococcus gammatolerans EJ3

Gene: TGAM_0281: Conserved hypothetical protein
 
Thermococcus kodakaraensis KOD1

Gene: TK1591: Conserved hypothetical protein
 
Thermococcus onnurineus NA1

Gene: TON_1741: Conserved hypothetical protein
 
Thermococcus sibiricus MM 739

Gene: TSIB_1803: Conserved hypothetical protein
Conserved hypothetical protein
 
CRON 4.
PF1050
 
Pyrococcus abyssi GE5

Gene: PAB0743: Conserved hypothetical protein
 
Pyrococcus furiosus DSM 3638

Gene: PF1050: Conserved hypothetical protein
 
Pyrococcus horikoshii OT3

Gene: PH1112: Conserved hypothetical protein
*
Thermococcus gammatolerans EJ3

Site:
position = -72
score = 6.12821
sequence = TTTAGTTACCTTTTGTATTTAAA

Gene: TGAM_1372: Conserved hypothetical protein
*
Thermococcus kodakaraensis KOD1

Site:
position = -84
score = 5.05798
sequence = TTTTCTTACCCATTGTTAAAATA

Site:
position = -68
score = 5.19327
sequence = TAAAATAACTTTTGGTATTTAAA

Gene: TK1120: Conserved hypothetical protein
 
Thermococcus onnurineus NA1

Gene: TON_0581: Conserved hypothetical protein
*
Thermococcus sibiricus MM 739

Site:
position = -172
score = 5.02081
sequence = TTTGTACACTTTTGGTTACTAAC

Site:
position = -158
score = 4.58721
sequence = GTTACTAACTTTGGGTTTATAAC

Gene: TSIB_1463: Conserved hypothetical protein
Conserved hypothetical protein
 
CRON 5.
PF0239
 
Pyrococcus abyssi GE5

Gene: PAB1112: Conserved hypothetical protein
*
Pyrococcus furiosus DSM 3638

Site:
position = -18
score = 5.24616
sequence = TTTAGTTACCTATTGTAAATGAT

Gene: PF0239: Conserved hypothetical protein
*
Pyrococcus horikoshii OT3

Site:
position = -18
score = 5.30584
sequence = TTTAGTTACCTTAGGTAAATGAT

Gene: PHS059: Conserved hypothetical protein
*
Thermococcus gammatolerans EJ3

Site:
position = -42
score = 4.59985
sequence = TTTAGTAACAATTCTTTAGGATA

Gene: TGAM_0090: Conserved hypothetical protein
*
Thermococcus kodakaraensis KOD1

Site:
position = -45
score = 5.87012
sequence = TTTAGTTACAATTTTTTATTAAA

Gene: TK2131: Conserved hypothetical protein
*
Thermococcus onnurineus NA1

Site:
position = -35
score = 5.25688
sequence = TTTAGTAACAATTCTTTAGAAAA

Gene: TON_1528: Conserved hypothetical protein
*
Thermococcus sibiricus MM 739

Site:
position = -23
score = 5.38842
sequence = TTTAGTTACTGATTCTTATTAAA

Gene: TSIB_0908: Conserved hypothetical protein
Conserved hypothetical protein
 
CRON 6.
PF0015
 
Pyrococcus abyssi GE5

Gene: PAB0075: Predicted chaperone
*
Pyrococcus furiosus DSM 3638

Site:
position = -41
score = 5.99709
sequence = TTTAATAACCTTTTGGAACTAAA

Gene: PF0015: Predicted chaperone
 
Pyrococcus horikoshii OT3

Gene: PH0126: Predicted chaperone
*
Thermococcus gammatolerans EJ3

Site:
position = -43
score = 5.92603
sequence = TTTAATAACCTTTTGGAAATAAA

Gene: TGAM_0133: Predicted chaperone
*
Thermococcus kodakaraensis KOD1

Site:
position = -42
score = 6.1766
sequence = TTTAATAACCTTTGGAAACTAAA

Gene: TK1896: Predicted chaperone
*
Thermococcus onnurineus NA1

Site:
position = -42
score = 6.13578
sequence = TTTAATAACCTTTAGAAACTAAA

Gene: TON_1650: Predicted chaperone
*
Thermococcus sibiricus MM 739

Site:
position = -41
score = 5.91711
sequence = TTTAATAACCTATAATTACTAAA

Gene: TSIB_1989: Predicted chaperone
Predicted chaperone
PF0014
 
Pyrococcus abyssi GE5

Gene: PAB0076: Conserved hypothetical protein
 
Pyrococcus furiosus DSM 3638

Gene: PF0014: Conserved hypothetical protein
 
Pyrococcus horikoshii OT3

Gene: PH0127: Conserved hypothetical protein
 
Thermococcus gammatolerans EJ3

Gene: TGAM_0132: Conserved hypothetical protein
 
Thermococcus kodakaraensis KOD1

Gene: TK1897: Conserved hypothetical protein
 
Thermococcus onnurineus NA1

Gene: TON_1649: Conserved hypothetical protein
 
Thermococcus sibiricus MM 739

Gene: TSIB_1990: Conserved hypothetical protein
Conserved hypothetical protein
 
CRON 7.
tip49
*
Pyrococcus abyssi GE5

Site:
position = -38
score = 5.71638
sequence = TTTAATAACCATTTGGAAGAAAA

Gene: PAB2107: TBP-interacting protein TIP49
*
Pyrococcus furiosus DSM 3638

Site:
position = -42
score = 5.66707
sequence = TTTAATAACAAAATGGAACAAAA

Gene: PF1847: TBP-interacting protein TIP49
*
Pyrococcus horikoshii OT3

Site:
position = -38
score = 5.85121
sequence = TTTAATTACTAAATGGAAATAAA

Gene: PH1804: TBP-interacting protein TIP49
*
Thermococcus gammatolerans EJ3

Site:
position = -48
score = 4.84193
sequence = TTTAGTTACCTTTGGATAGATTA

Gene: TGAM_1545: TBP-interacting protein TIP49
*
Thermococcus kodakaraensis KOD1

Site:
position = -42
score = 5.04858
sequence = TTTAGTAACCTTCGGTATTCTAA

Gene: TK1199: TBP-interacting protein TIP49
 
Thermococcus onnurineus NA1

Gene: TON_0462: TBP-interacting protein TIP49
*
Thermococcus sibiricus MM 739

Site:
position = -45
score = 5.91437
sequence = TTTAAATACCAATAGTTTCTAAA

Gene: TSIB_1591: TBP-interacting protein TIP49
TBP-interacting protein TIP49
 
CRON 8.
hsp20
*
Pyrococcus abyssi GE5

Site:
position = -43
score = 6.24803
sequence = TTTAATTACTATTGGTAACAAAA

Gene: PAB2072: Small heat shock protein 20
*
Pyrococcus furiosus DSM 3638

Site:
position = -43
score = 6.25215
sequence = TTTAATAACTAATGGTAACCAAA

Gene: PF1883: Small heat shock protein 20
*
Pyrococcus horikoshii OT3

Site:
position = -24
score = 6.24
sequence = TTTAGTAACTAATGGTAACCAAA

Gene: PH1842: Small heat shock protein 20
*
Thermococcus gammatolerans EJ3

Site:
position = -99
score = 5.02724
sequence = TTTAGTCACCTTTTGTATGGTAA

Site:
position = -50
score = 5.90851
sequence = TTTAGTAACTACTGGTAACCAAA

Gene: TGAM_1688: Small heat shock protein 20
*
Thermococcus kodakaraensis KOD1

Site:
position = -73
score = 4.9165
sequence = TTTGGTAACTTTCGGAGAGAAAA

Site:
position = -32
score = 5.99886
sequence = TTTAATAACAATTGGTGAGAAAA

Gene: TK1155: Small heat shock protein 20
*
Thermococcus onnurineus NA1

Site:
position = -41
score = 5.8745
sequence = TTTAGTTACTACTGGTAACCAAA

Gene: TON_1113: Small heat shock protein 20
*
Thermococcus sibiricus MM 739

Site:
position = -11
score = 6.25215
sequence = TTTAATAACTATTGGTAACCAAA

Gene: TSIB_0520: Small heat shock protein 20
Small heat shock protein 20
vat
*
Pyrococcus abyssi GE5

Site:
position = -40
score = 6.12358
sequence = TTTAGTAACCATTGGTAAAGAAA

Gene: PAB2086: ATPase, AAA+ family
*
Pyrococcus furiosus DSM 3638

Site:
position = -41
score = 6.29297
sequence = TTTAGTAACCATTGGTAATCAAA

Gene: PF1882: ATPase, AAA+ family
*
Pyrococcus horikoshii OT3

Site:
position = -30
score = 6.19883
sequence = TTTAGTAACCATTAGTAAAAAAA

Gene: PH1840: ATPase, AAA+ family
 
Thermococcus gammatolerans EJ3

Gene: TGAM_1689: ATPase, AAA+ family
*
Thermococcus kodakaraensis KOD1

Site:
position = -91
score = 4.65083
sequence = TTTGGTAACCTCACTTAAGAAAA

Site:
position = -41
score = 5.78409
sequence = TTTAGTAACTTACGGTAACCAAA

Gene: TK1157: ATPase, AAA+ family
 
Thermococcus onnurineus NA1

Gene: TON_1114: ATPase, AAA+ family
 
Thermococcus sibiricus MM 739

Gene: TSIB_0521: ATPase, AAA+ family
ATPase, AAA+ family
 
CRON 9.
phr
*
Pyrococcus abyssi GE5

Site:
position = -55
score = 5.6309
sequence = TTTTCTAACATTGGGTTAGAAAA

Gene: PAB0208: Heat shock response regulator Phr, ArsR family
*
Pyrococcus furiosus DSM 3638

Site:
position = -44
score = 6.0242
sequence = TTTACTTACAATATGTTAGAAAA

Gene: PF1790: Heat shock response regulator Phr, ArsR family
 
Pyrococcus horikoshii OT3

Gene: PH1744: Heat shock response regulator Phr, ArsR family
*
Thermococcus gammatolerans EJ3

Site:
position = -41
score = 5.53612
sequence = TTTTCTAACATTAAGTTAGTAAG

Gene: TGAM_0854: Heat shock response regulator Phr, ArsR family
*
Thermococcus kodakaraensis KOD1

Site:
position = -37
score = 5.32412
sequence = TTTACTAACTTTGGGTTAGGGAA

Gene: TK2291: Heat shock response regulator Phr, ArsR family
*
Thermococcus onnurineus NA1

Site:
position = -41
score = 5.19765
sequence = TTTTCTTACATTAAGTTAGGGAA

Gene: TON_1231: Heat shock response regulator Phr, ArsR family
*
Thermococcus sibiricus MM 739

Site:
position = -48
score = 5.04413
sequence = TTTATTTACATTAGGTTAGATTA

Gene: TSIB_1608: Heat shock response regulator Phr, ArsR family
Heat shock response regulator Phr, ArsR family
 
CRON 10.
inoS
 
Pyrococcus abyssi GE5

Gene: PAB1989: Inositol-1-phosphate synthase (EC 5.5.1.4)
*
Pyrococcus furiosus DSM 3638

Site:
position = -119
score = 5.16363
sequence = TTTATAAACCAAAGTTACTTAAA

Site:
position = -66
score = 5.03016
sequence = TTTTGTCTATAAAAGTTAATAAA

Gene: PF1616: Inositol-1-phosphate synthase (EC 5.5.1.4)
 
Pyrococcus horikoshii OT3

Gene: PH1605: Inositol-1-phosphate synthase (EC 5.5.1.4)
 
Thermococcus gammatolerans EJ3

Gene: TGAM_1848: Inositol-1-phosphate synthase (EC 5.5.1.4)
 
Thermococcus kodakaraensis KOD1

Gene: TK2278: Inositol-1-phosphate synthase (EC 5.5.1.4)
 
Thermococcus onnurineus NA1

Gene: TON_1249: Inositol-1-phosphate synthase (EC 5.5.1.4)
 
Thermococcus sibiricus MM 739

Gene: TSIB_1788: Inositol-1-phosphate synthase (EC 5.5.1.4)
Inositol-1-phosphate synthase (EC 5.5.1.4)
 
CRON 11.
PF1488
*
Pyrococcus abyssi GE5

Site:
position = -24
score = 6.26716
sequence = TTTAATAACTAAAGGTGAGTAAA

Gene: PAB1806: Conserved hypothetical protein
*
Pyrococcus furiosus DSM 3638

Site:
position = -59
score = 5.0452
sequence = TTTTCTCACCAAATGATTTAAAA

Site:
position = -25
score = 5.86393
sequence = TTTAATAACAAATGGTGAAGAAA

Gene: PF1488: Conserved hypothetical protein
*
Pyrococcus horikoshii OT3

Site:
position = -14
score = 6.29172
sequence = TTTAATAACAATAGGTGATTAAA

Gene: PH1314: Conserved hypothetical protein
*
Thermococcus gammatolerans EJ3

Site:
position = -23
score = 6.0124
sequence = TTTAATAACAAAAGGTGATCAAA

Gene: TGAM_0505: Conserved hypothetical protein
*
Thermococcus kodakaraensis KOD1

Site:
position = -23
score = 5.94248
sequence = TTTACTAACCTTTGGTGATGAAA

Gene: TK2294: Conserved hypothetical protein
 
Thermococcus onnurineus NA1
 
Thermococcus sibiricus MM 739
Conserved hypothetical protein
PF1489
 
Pyrococcus abyssi GE5

Gene: PAB1807: Conserved hypothetical protein
 
Pyrococcus furiosus DSM 3638

Gene: PF1489: Conserved hypothetical protein
 
Pyrococcus horikoshii OT3

Gene: PH1315: Conserved hypothetical protein
 
Thermococcus gammatolerans EJ3
 
Thermococcus kodakaraensis KOD1
 
Thermococcus onnurineus NA1
 
Thermococcus sibiricus MM 739
Conserved hypothetical protein
 
CRON 12.
impD
*
Pyrococcus abyssi GE5

Site:
position = -92
score = 5.79411
sequence = TTTATTAACCTTTTCTTACTAAA

Gene: PAB0961: Inosine monophosphate dehydrogenase
*
Pyrococcus furiosus DSM 3638

Site:
position = -93
score = 5.9612
sequence = TTTATTAACCAAAGTTTACTAAA

Gene: PF0321: Inosine monophosphate dehydrogenase
*
Pyrococcus horikoshii OT3

Site:
position = -90
score = 5.54712
sequence = TTTATTAACCTTTCTTTACTAAA

Site:
position = -47
score = 4.9783
sequence = TTTAAATTCCAAGGGAGAGTAAA

Gene: PH0600: Inosine monophosphate dehydrogenase
*
Thermococcus gammatolerans EJ3

Site:
position = -89
score = 5.57478
sequence = TTTATTAACCTGAGTTAACTAAA

Gene: TGAM_0730: Inosine monophosphate dehydrogenase
*
Thermococcus kodakaraensis KOD1

Site:
position = -93
score = 5.58724
sequence = TTTATTAACCTAACGTTACTTAA

Gene: TK1186: Inosine monophosphate dehydrogenase
*
Thermococcus onnurineus NA1

Site:
position = -95
score = 5.4922
sequence = TTTATTAACCTAACTTAACTAAA

Gene: TON_0361: Inosine monophosphate dehydrogenase
*
Thermococcus sibiricus MM 739

Site:
position = -85
score = 6.25477
sequence = TTTATTAACTTAATGTAAATAAA

Gene: TSIB_1314: Inosine monophosphate dehydrogenase
Inosine monophosphate dehydrogenase
 
CRON 13.
PF1291
*
Pyrococcus abyssi GE5

Site:
position = -38
score = 5.6218
sequence = TTTAGTTAATTTTGGTAAGAAAA

Gene: PAB1723: Putative metallophosphoesterase
*
Pyrococcus furiosus DSM 3638

Site:
position = -39
score = 5.6218
sequence = TTTAGTTAATTTTGGTAAGAAAA

Gene: PF1291: Putative metallophosphoesterase
*
Pyrococcus horikoshii OT3

Site:
position = -38
score = 5.6218
sequence = TTTAGTTAATTTTGGTAAGAAAA

Gene: PH1004: Putative metallophosphoesterase
*
Thermococcus gammatolerans EJ3

Site:
position = -38
score = 5.76708
sequence = TTTAGTTTCTTTAGGTAAGAAAA

Gene: TGAM_1955: Putative metallophosphoesterase
*
Thermococcus kodakaraensis KOD1

Site:
position = -38
score = 5.36453
sequence = TTTATTTTCTTCAGGTAAGAAAA

Gene: TK1492: Putative metallophosphoesterase
*
Thermococcus onnurineus NA1

Site:
position = -36
score = 5.32251
sequence = TTTAGTTAATTTGAGTAAGAAAA

Gene: TON_0117: Putative metallophosphoesterase
 
Thermococcus sibiricus MM 739
Putative metallophosphoesterase
 
CRON 14.
PF1042
*
Pyrococcus abyssi GE5

Site:
position = -38
score = 6.09013
sequence = TTTAAATACTTTTAGTTAATAAA

Gene: PAB0736: Conserved hypothetical protein (Have distant homology to the Chromosome partition protein Smc)
*
Pyrococcus furiosus DSM 3638

Site:
position = -38
score = 5.82353
sequence = TTTAAGCACTAAAAGTTATTAAA

Gene: PF1042: Conserved hypothetical protein (Have distant homology to the Chromosome partition protein Smc)
*
Pyrococcus horikoshii OT3

Site:
position = -39
score = 6.13356
sequence = TTTAAATACATTTAGTTATTAAA

Gene: PH1122: Conserved hypothetical protein (Have distant homology to the Chromosome partition protein Smc)
*
Thermococcus gammatolerans EJ3

Site:
position = -33
score = 5.96279
sequence = TTTAAGAACAAAAAGTAACTAAA

Gene: TGAM_1491: Conserved hypothetical protein (Have distant homology to the Chromosome partition protein Smc)
*
Thermococcus kodakaraensis KOD1

Site:
position = -53
score = 6.09378
sequence = TTTAAATACAAAATGTTATTAAA

Gene: TK1097: Conserved hypothetical protein (Have distant homology to the Chromosome partition protein Smc)
 
Thermococcus onnurineus NA1
 
Thermococcus sibiricus MM 739
Conserved hypothetical protein (Have distant homology to the Chromosome partition protein Smc)
 
CRON 15.
PF0624
 
Pyrococcus abyssi GE5
*
Pyrococcus furiosus DSM 3638

Site:
position = -45
score = 6.03819
sequence = TTTATATACTTTTTGTTACTAAA

Gene: PF0624: Conserved hypothetical protein
 
Pyrococcus horikoshii OT3
*
Thermococcus gammatolerans EJ3

Site:
position = -55
score = 5.62275
sequence = TTTATATACTCTGGGTTACTAAA

Gene: TGAM_0933: Conserved hypothetical protein
*
Thermococcus kodakaraensis KOD1

Site:
position = -56
score = 5.86031
sequence = TTTATATACTCAAGGTTACTAAA

Gene: TK0750: Conserved hypothetical protein
 
Thermococcus onnurineus NA1
*
Thermococcus sibiricus MM 739

Site:
position = -62
score = 6.00418
sequence = TTTATATACTTATTGTAACTAAA

Gene: TSIB_0871: Conserved hypothetical protein
Conserved hypothetical protein
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD