Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog AAur_4078 - Micrococcineae

Properties
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Galactosides utilization
Effector:
Phylum: Actinobacteria
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 21 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Arthrobacter aurescens TC1 5 2
Arthrobacter chlorophenolicus A6
Arthrobacter sp. FB24
Beutenbergia cavernae DSM 12333 6 2
Brachybacterium faecium DSM 4810 11 3
Brevibacterium linens BL2
Clavibacter michiganensis subsp. michiganensis NCPPB 382
Janibacter sp. HTCC2649
Jonesia denitrificans DSM 20603 7 4
Kocuria rhizophila DC2201
Kytococcus sedentarius DSM 20547
Leifsonia xyli subsp. xyli str. CTCB07
Renibacterium salmoninarum ATCC 33209
Tropheryma whipplei str. Twist
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
Bfae_04140
 
Arthrobacter aurescens TC1
 
Arthrobacter chlorophenolicus A6
 
Arthrobacter sp. FB24
 
Beutenbergia cavernae DSM 12333
*
Brachybacterium faecium DSM 4810

Site:
position = -121
score = 5.74681
sequence = TACTGTAATCGATCACAGTC

Gene: Bfae_04140: Predicted galactosides ABC transporter, substrate-binding protein
 
Brevibacterium linens BL2
 
Clavibacter michiganensis subsp. michiganensis NCPPB 382
 
Janibacter sp. HTCC2649
 
Jonesia denitrificans DSM 20603
 
Kocuria rhizophila DC2201
 
Kytococcus sedentarius DSM 20547
 
Leifsonia xyli subsp. xyli str. CTCB07
 
Renibacterium salmoninarum ATCC 33209
 
Tropheryma whipplei str. Twist
Predicted galactosides ABC transporter, substrate-binding protein
Bfae_04130
 
Arthrobacter aurescens TC1
 
Arthrobacter chlorophenolicus A6
 
Arthrobacter sp. FB24
 
Beutenbergia cavernae DSM 12333
 
Brachybacterium faecium DSM 4810

Gene: Bfae_04130: Predicted galactosides ABC transporter, permease protein 2
 
Brevibacterium linens BL2
 
Clavibacter michiganensis subsp. michiganensis NCPPB 382
 
Janibacter sp. HTCC2649
 
Jonesia denitrificans DSM 20603
 
Kocuria rhizophila DC2201
 
Kytococcus sedentarius DSM 20547
 
Leifsonia xyli subsp. xyli str. CTCB07
 
Renibacterium salmoninarum ATCC 33209
 
Tropheryma whipplei str. Twist
Predicted galactosides ABC transporter, permease protein 2
Bfae_04120
 
Arthrobacter aurescens TC1
 
Arthrobacter chlorophenolicus A6
 
Arthrobacter sp. FB24
 
Beutenbergia cavernae DSM 12333
 
Brachybacterium faecium DSM 4810

Gene: Bfae_04120: Predicted galactosides ABC transporter, permease protein 1
 
Brevibacterium linens BL2
 
Clavibacter michiganensis subsp. michiganensis NCPPB 382
 
Janibacter sp. HTCC2649
 
Jonesia denitrificans DSM 20603
 
Kocuria rhizophila DC2201
 
Kytococcus sedentarius DSM 20547
 
Leifsonia xyli subsp. xyli str. CTCB07
 
Renibacterium salmoninarum ATCC 33209
 
Tropheryma whipplei str. Twist
Predicted galactosides ABC transporter, permease protein 1
ganA3
 
Arthrobacter aurescens TC1
 
Arthrobacter chlorophenolicus A6
 
Arthrobacter sp. FB24
 
Beutenbergia cavernae DSM 12333
 2
Brachybacterium faecium DSM 4810

Gene: Bfae_04110: Arabinogalactan endo-1,4-beta-galactosidase (EC 3.2.1.89)

Gene: Bfae_04100: Arabinogalactan endo-1,4-beta-galactosidase (EC 3.2.1.89)
 
Brevibacterium linens BL2
 
Clavibacter michiganensis subsp. michiganensis NCPPB 382
 
Janibacter sp. HTCC2649
 
Jonesia denitrificans DSM 20603
 
Kocuria rhizophila DC2201
 
Kytococcus sedentarius DSM 20547
 
Leifsonia xyli subsp. xyli str. CTCB07
 
Renibacterium salmoninarum ATCC 33209
 
Tropheryma whipplei str. Twist
Arabinogalactan endo-1,4-beta-galactosidase (EC 3.2.1.89)
 
CRON 2.
ganA2
 
Arthrobacter aurescens TC1
 
Arthrobacter chlorophenolicus A6
 
Arthrobacter sp. FB24
 
Beutenbergia cavernae DSM 12333
 
Brachybacterium faecium DSM 4810
 
Brevibacterium linens BL2
 
Clavibacter michiganensis subsp. michiganensis NCPPB 382
 
Janibacter sp. HTCC2649
*
Jonesia denitrificans DSM 20603

Site:
position = -49
score = 5.14695
sequence = GTCTGTGACCGGTCACAGAC

Site:
position = -136
score = 5.77052
sequence = CACTGGGAGCGGGCACAGTT

Gene: Jden_2125: Arabinogalactan endo-1,4-beta-galactosidase (EC 3.2.1.89)
 
Kocuria rhizophila DC2201
 
Kytococcus sedentarius DSM 20547
 
Leifsonia xyli subsp. xyli str. CTCB07
 
Renibacterium salmoninarum ATCC 33209
 
Tropheryma whipplei str. Twist
Arabinogalactan endo-1,4-beta-galactosidase (EC 3.2.1.89)
 
CRON 3.
SAV_1326
*
Arthrobacter aurescens TC1

Site:
position = -177
score = 5.87147
sequence = AACTGTGTGCGCTCCCAGTA

Site:
position = -90
score = 5.9381
sequence = AACTGGAACCGCTCACAGTC

Gene: AAur_4081: Predicted galactosides ABC transporter, substrate-binding protein
 
Arthrobacter chlorophenolicus A6
 
Arthrobacter sp. FB24
 
Beutenbergia cavernae DSM 12333
*
Brachybacterium faecium DSM 4810

Site:
position = -79
score = 5.86552
sequence = GACTGTAAACGATCACAGTT

Site:
position = -179
score = 4.90849
sequence = AACTGGAATCGATCACGGGT

Gene: Bfae_04000: Predicted galactosides ABC transporter, substrate-binding protein
 
Brevibacterium linens BL2
 
Clavibacter michiganensis subsp. michiganensis NCPPB 382
 
Janibacter sp. HTCC2649
*
Jonesia denitrificans DSM 20603

Site:
position = -178
score = 5.549
sequence = CGCTGTGCGCGGTCACAGCC

Site:
position = -89
score = 5.52215
sequence = TCCTGTGACCGGTCACAGCG

Gene: Jden_0310: Predicted galactosides ABC transporter, substrate-binding protein
 
Kocuria rhizophila DC2201
 
Kytococcus sedentarius DSM 20547
 
Leifsonia xyli subsp. xyli str. CTCB07
 
Renibacterium salmoninarum ATCC 33209
 
Tropheryma whipplei str. Twist
Predicted galactosides ABC transporter, substrate-binding protein
SAV_1327
 
Arthrobacter aurescens TC1

Gene: AAur_4080: Predicted galactosides ABC transporter, permease protein 1
 
Arthrobacter chlorophenolicus A6
 
Arthrobacter sp. FB24
 
Beutenbergia cavernae DSM 12333
 
Brachybacterium faecium DSM 4810

Gene: Bfae_04010: Predicted galactosides ABC transporter, permease protein 1
 
Brevibacterium linens BL2
 
Clavibacter michiganensis subsp. michiganensis NCPPB 382
 
Janibacter sp. HTCC2649
 
Jonesia denitrificans DSM 20603

Gene: Jden_0309: Predicted galactosides ABC transporter, permease protein 1
 
Kocuria rhizophila DC2201
 
Kytococcus sedentarius DSM 20547
 
Leifsonia xyli subsp. xyli str. CTCB07
 
Renibacterium salmoninarum ATCC 33209
 
Tropheryma whipplei str. Twist
Predicted galactosides ABC transporter, permease protein 1
SAV_1328
 
Arthrobacter aurescens TC1

Gene: AAur_4079: Predicted galactosides ABC transporter, permease protein 2
 
Arthrobacter chlorophenolicus A6
 
Arthrobacter sp. FB24
 
Beutenbergia cavernae DSM 12333
 
Brachybacterium faecium DSM 4810

Gene: Bfae_04020: Predicted galactosides ABC transporter, permease protein 2
 
Brevibacterium linens BL2
 
Clavibacter michiganensis subsp. michiganensis NCPPB 382
 
Janibacter sp. HTCC2649
 
Jonesia denitrificans DSM 20603

Gene: Jden_0308: Predicted galactosides ABC transporter, permease protein 2
 
Kocuria rhizophila DC2201
 
Kytococcus sedentarius DSM 20547
 
Leifsonia xyli subsp. xyli str. CTCB07
 
Renibacterium salmoninarum ATCC 33209
 
Tropheryma whipplei str. Twist
Predicted galactosides ABC transporter, permease protein 2
SAV_1329
 
Arthrobacter aurescens TC1

Gene: AAur_4078: Predicted galactosides utilization transcriptional regulator, LacI-family
 
Arthrobacter chlorophenolicus A6
 
Arthrobacter sp. FB24
*
Beutenbergia cavernae DSM 12333

Site:
position = -73
score = 5.05964
sequence = AACCGTGATCGTGCACAGGA

Site:
position = -142
score = 5.3892
sequence = GGCTGGGACCGTGCACAGCA

Gene: Bcav_3075: Predicted galactosides utilization transcriptional regulator, LacI-family
 
Brachybacterium faecium DSM 4810

Gene: Bfae_04030: Predicted galactosides utilization transcriptional regulator, LacI-family
 
Brevibacterium linens BL2
 
Clavibacter michiganensis subsp. michiganensis NCPPB 382
 
Janibacter sp. HTCC2649
 
Jonesia denitrificans DSM 20603

Gene: Jden_0307: Predicted galactosides utilization transcriptional regulator, LacI-family
 
Kocuria rhizophila DC2201
 
Kytococcus sedentarius DSM 20547
 
Leifsonia xyli subsp. xyli str. CTCB07
 
Renibacterium salmoninarum ATCC 33209
 
Tropheryma whipplei str. Twist
Predicted galactosides utilization transcriptional regulator, LacI-family
 
CRON 4.
lacA
*
Arthrobacter aurescens TC1

Site:
position = -123
score = 5.9381
sequence = GACTGTGAGCGGTTCCAGTT

Site:
position = -36
score = 5.87147
sequence = TACTGGGAGCGCACACAGTT

Gene: AAur_4082: Beta-galactosidase (EC 3.2.1.23)
 
Arthrobacter chlorophenolicus A6
 
Arthrobacter sp. FB24
*
Beutenbergia cavernae DSM 12333

Site:
position = -147
score = 5.05964
sequence = TCCTGTGCACGATCACGGTT

Site:
position = -78
score = 5.3892
sequence = TGCTGTGCACGGTCCCAGCC

Gene: Bcav_3076: Beta-galactosidase (EC 3.2.1.23)
*
Brachybacterium faecium DSM 4810

Site:
position = 3
score = 4.90849
sequence = ACCCGTGATCGATTCCAGTT

Site:
position = -97
score = 5.86552
sequence = AACTGTGATCGTTTACAGTC

Gene: Bfae_03990: Beta-galactosidase (EC 3.2.1.23)
 
Brevibacterium linens BL2
 
Clavibacter michiganensis subsp. michiganensis NCPPB 382
 
Janibacter sp. HTCC2649
*
Jonesia denitrificans DSM 20603

Site:
position = -154
score = 5.52215
sequence = CGCTGTGACCGGTCACAGGA

Site:
position = -65
score = 5.549
sequence = GGCTGTGACCGCGCACAGCG

Gene: Jden_0311: Beta-galactosidase (EC 3.2.1.23)
 
Kocuria rhizophila DC2201
 
Kytococcus sedentarius DSM 20547
 
Leifsonia xyli subsp. xyli str. CTCB07
 
Renibacterium salmoninarum ATCC 33209
 
Tropheryma whipplei str. Twist
Beta-galactosidase (EC 3.2.1.23)
Bcav_3077
 
Arthrobacter aurescens TC1
 
Arthrobacter chlorophenolicus A6
 
Arthrobacter sp. FB24
 
Beutenbergia cavernae DSM 12333

Gene: Bcav_3077: Predicted galactosides ABC transporter, substrate-binding protein
 
Brachybacterium faecium DSM 4810
 
Brevibacterium linens BL2
 
Clavibacter michiganensis subsp. michiganensis NCPPB 382
 
Janibacter sp. HTCC2649
 
Jonesia denitrificans DSM 20603
 
Kocuria rhizophila DC2201
 
Kytococcus sedentarius DSM 20547
 
Leifsonia xyli subsp. xyli str. CTCB07
 
Renibacterium salmoninarum ATCC 33209
 
Tropheryma whipplei str. Twist
Predicted galactosides ABC transporter, substrate-binding protein
Bcav_3078
 
Arthrobacter aurescens TC1
 
Arthrobacter chlorophenolicus A6
 
Arthrobacter sp. FB24
 
Beutenbergia cavernae DSM 12333

Gene: Bcav_3078: Predicted galactosides ABC transporter, permease protein
 
Brachybacterium faecium DSM 4810
 
Brevibacterium linens BL2
 
Clavibacter michiganensis subsp. michiganensis NCPPB 382
 
Janibacter sp. HTCC2649
 
Jonesia denitrificans DSM 20603
 
Kocuria rhizophila DC2201
 
Kytococcus sedentarius DSM 20547
 
Leifsonia xyli subsp. xyli str. CTCB07
 
Renibacterium salmoninarum ATCC 33209
 
Tropheryma whipplei str. Twist
Predicted galactosides ABC transporter, permease protein
Bcav_3079
 
Arthrobacter aurescens TC1
 
Arthrobacter chlorophenolicus A6
 
Arthrobacter sp. FB24
 
Beutenbergia cavernae DSM 12333

Gene: Bcav_3079: Predicted galactosides ABC transporter, permease protein 2
 
Brachybacterium faecium DSM 4810
 
Brevibacterium linens BL2
 
Clavibacter michiganensis subsp. michiganensis NCPPB 382
 
Janibacter sp. HTCC2649
 
Jonesia denitrificans DSM 20603
 
Kocuria rhizophila DC2201
 
Kytococcus sedentarius DSM 20547
 
Leifsonia xyli subsp. xyli str. CTCB07
 
Renibacterium salmoninarum ATCC 33209
 
Tropheryma whipplei str. Twist
Predicted galactosides ABC transporter, permease protein 2
ganA
 
Arthrobacter aurescens TC1
 
Arthrobacter chlorophenolicus A6
 
Arthrobacter sp. FB24
 
Beutenbergia cavernae DSM 12333

Gene: Bcav_3080: Arabinogalactan endo-1,4-beta-galactosidase (EC 3.2.1.89)
 
Brachybacterium faecium DSM 4810

Gene: Bfae_03980: Arabinogalactan endo-1,4-beta-galactosidase (EC 3.2.1.89)
 
Brevibacterium linens BL2
 
Clavibacter michiganensis subsp. michiganensis NCPPB 382
 
Janibacter sp. HTCC2649
*
Jonesia denitrificans DSM 20603

Site:
position = -213
score = 6.02476
sequence = AACTGGGAGCGCGCACAGTC

Site:
position = -135
score = 5.45619
sequence = CCCTGTGACCGGTTACAGTA

Gene: Jden_0385: Arabinogalactan endo-1,4-beta-galactosidase (EC 3.2.1.89)
 
Kocuria rhizophila DC2201
 
Kytococcus sedentarius DSM 20547
 
Leifsonia xyli subsp. xyli str. CTCB07
 
Renibacterium salmoninarum ATCC 33209
 
Tropheryma whipplei str. Twist
Arabinogalactan endo-1,4-beta-galactosidase (EC 3.2.1.89)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD