Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog MdxR - Listeriaceae

Properties
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Maltodextrin utilization; Maltose utilization
Effector: Maltose
Phylum: Firmicutes
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 8 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Listeria innocua Clip11262 6 2
Listeria monocytogenes EGD-e 6 2
Listeria seeligeri serovar 1/2b str. SLCC3954 6 2
Listeria welshimeri serovar 6b str. SLCC5334 6 2
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
mdxE
*
Listeria innocua Clip11262

Site:
position = -172
score = 5.85679
sequence = TGTTGTTATCGGTAACATGT

Gene: lin2230: Maltose/Maltodextrin ABC transporter, substrate binding periplasmic protein
*
Listeria monocytogenes EGD-e

Site:
position = -171
score = 5.85679
sequence = TGTTGTTATCGGTAACATGT

Gene: lmo2125: Maltose/Maltodextrin ABC transporter, substrate binding periplasmic protein
*
Listeria seeligeri serovar 1/2b str. SLCC3954

Site:
position = -171
score = 5.85679
sequence = TGTTGTTATCGGTAACATGT

Gene: lse_2114: Maltose/Maltodextrin ABC transporter, substrate binding periplasmic protein
*
Listeria welshimeri serovar 6b str. SLCC5334

Site:
position = -170
score = 5.85679
sequence = TGTTGTTATCGGTAACATGT

Gene: lwe2145: Maltose/Maltodextrin ABC transporter, substrate binding periplasmic protein
Maltose/Maltodextrin ABC transporter, substrate binding periplasmic protein
mdxF
 
Listeria innocua Clip11262

Gene: lin2229: Maltose/Maltodextrin ABC transporter, permease protein
 
Listeria monocytogenes EGD-e

Gene: lmo2124: Maltose/Maltodextrin ABC transporter, permease protein
 
Listeria seeligeri serovar 1/2b str. SLCC3954

Gene: lse_2113: Maltose/Maltodextrin ABC transporter, permease protein
 
Listeria welshimeri serovar 6b str. SLCC5334

Gene: lwe2144: Maltose/Maltodextrin ABC transporter, permease protein
Maltose/Maltodextrin ABC transporter, permease protein
mdxG
 
Listeria innocua Clip11262

Gene: lin2228: Maltose/Maltodextrin ABC transporter, permease protein
 
Listeria monocytogenes EGD-e

Gene: lmo2123: Maltose/Maltodextrin ABC transporter, permease protein
 
Listeria seeligeri serovar 1/2b str. SLCC3954

Gene: lse_2112: Maltose/Maltodextrin ABC transporter, permease protein
 
Listeria welshimeri serovar 6b str. SLCC5334

Gene: lwe2143: Maltose/Maltodextrin ABC transporter, permease protein
Maltose/Maltodextrin ABC transporter, permease protein
malA
 
Listeria innocua Clip11262

Gene: lin2227: Putative maltodextrin utilization protein
 
Listeria monocytogenes EGD-e

Gene: lmo2122: Putative maltodextrin utilization protein
 
Listeria seeligeri serovar 1/2b str. SLCC3954

Gene: lse_2111: Putative maltodextrin utilization protein
 
Listeria welshimeri serovar 6b str. SLCC5334

Gene: lwe2142: Putative maltodextrin utilization protein
Putative maltodextrin utilization protein
malK
 
Listeria innocua Clip11262

Gene: lin2226: Maltose phosphorylase (EC 2.4.1.8)
 
Listeria monocytogenes EGD-e

Gene: lmo2121: Maltose phosphorylase (EC 2.4.1.8)
 
Listeria seeligeri serovar 1/2b str. SLCC3954

Gene: lse_2110: Maltose phosphorylase (EC 2.4.1.8)
 
Listeria welshimeri serovar 6b str. SLCC5334

Gene: lwe2141: Maltose phosphorylase (EC 2.4.1.8)
Maltose phosphorylase (EC 2.4.1.8)
 
CRON 2.
mdxD
*
Listeria innocua Clip11262

Site:
position = -94
score = 6.51366
sequence = TCTTGTTACCGTTAACGAGC

Gene: lin2231: Intracellular maltogenic amylase
*
Listeria monocytogenes EGD-e

Site:
position = -94
score = 6.51366
sequence = TCTTGTTACCGTTAACGAGC

Gene: lmo2126: Intracellular maltogenic amylase
*
Listeria seeligeri serovar 1/2b str. SLCC3954

Site:
position = -95
score = 6.51366
sequence = TCTTGTTACCGTTAACGAGC

Gene: lse_2115: Intracellular maltogenic amylase
*
Listeria welshimeri serovar 6b str. SLCC5334

Site:
position = -94
score = 6.51366
sequence = TCTTGTTACCGTTAACGAGC

Gene: lwe2146: Intracellular maltogenic amylase
Intracellular maltogenic amylase
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD