Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog Bcav_0107 - Micrococcineae

Properties
Regulator type: Transcription factor
Regulator family: GntR/Others
Regulation mode:
Biological process: Multidrug efflux
Effector:
Phylum: Actinobacteria
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 2 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Arthrobacter aurescens TC1
Arthrobacter chlorophenolicus A6
Arthrobacter sp. FB24
Beutenbergia cavernae DSM 12333 2 1
Brachybacterium faecium DSM 4810
Brevibacterium linens BL2
Clavibacter michiganensis subsp. michiganensis NCPPB 382 2 1
Janibacter sp. HTCC2649
Jonesia denitrificans DSM 20603
Kocuria rhizophila DC2201
Kytococcus sedentarius DSM 20547
Leifsonia xyli subsp. xyli str. CTCB07
Renibacterium salmoninarum ATCC 33209
Tropheryma whipplei str. Twist
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
Bcav_0107
 
Arthrobacter aurescens TC1
 
Arthrobacter chlorophenolicus A6
 
Arthrobacter sp. FB24
*
Beutenbergia cavernae DSM 12333

Site:
position = -21
score = 5.15192
sequence = TTGTTCTAGTAGAATACGAACAT

Gene: Bcav_0107: Transcriptional regulator, GntR family
 
Brachybacterium faecium DSM 4810
 
Brevibacterium linens BL2
*
Clavibacter michiganensis subsp. michiganensis NCPPB 382

Site:
position = -21
score = 5.5989
sequence = TTGTTCGCATAGAATGCGAACAT

Gene: CMM_2354: Transcriptional regulator, GntR family
 
Janibacter sp. HTCC2649
 
Jonesia denitrificans DSM 20603
 
Kocuria rhizophila DC2201
 
Kytococcus sedentarius DSM 20547
 
Leifsonia xyli subsp. xyli str. CTCB07
 
Renibacterium salmoninarum ATCC 33209
 
Tropheryma whipplei str. Twist
Transcriptional regulator, GntR family
SCO3813
 
Arthrobacter aurescens TC1
 
Arthrobacter chlorophenolicus A6
 
Arthrobacter sp. FB24
 
Beutenbergia cavernae DSM 12333

Gene: Bcav_0108: integral membrane protein
 
Brachybacterium faecium DSM 4810
 
Brevibacterium linens BL2
 
Clavibacter michiganensis subsp. michiganensis NCPPB 382

Gene: CMM_2353: integral membrane protein
 
Janibacter sp. HTCC2649
 
Jonesia denitrificans DSM 20603
 
Kocuria rhizophila DC2201
 
Kytococcus sedentarius DSM 20547
 
Leifsonia xyli subsp. xyli str. CTCB07
 
Renibacterium salmoninarum ATCC 33209
 
Tropheryma whipplei str. Twist
integral membrane protein
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD