Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog XAC1548 - Xanthomonadales

Properties
Regulator type: Transcription factor
Regulator family: GntR/Others
Regulation mode:
Biological process: Multidrug resistance; Multidrug efflux
Effector:
Phylum: Proteobacteria/Gamma
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 6 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Stenotrophomonas maltophilia K279a 4 2
Xanthomonas axonopodis pv. citri str. 306 4 2
Xanthomonas campestris pv. campestris str. ATCC 33913 4 2
Xylella fastidiosa 9a5c
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
XAC0231
*
Stenotrophomonas maltophilia K279a

Site:
position = -55
score = 5.4786
sequence = TGGTGTACTACCTTACTACCACACCA

Gene: Smlt0201: hypothetical protein
*
Xanthomonas axonopodis pv. citri str. 306

Site:
position = -54
score = 5.3264
sequence = CGGTGTACTACCTTACTACCACACCA

Gene: XAC0231: hypothetical protein
*
Xanthomonas campestris pv. campestris str. ATCC 33913

Site:
position = -54
score = 5.3264
sequence = CGGTGTACTACCTTACTACCACACCA

Gene: XCC0210: hypothetical protein
 
Xylella fastidiosa 9a5c
hypothetical protein
 
CRON 2.
XAC1548
*
Stenotrophomonas maltophilia K279a

Site:
position = -288
score = 6.48347
sequence = CGGTGTTATAGTTGCATACAACACCA

Gene: Smlt3185: Transcriptional regulator, GntR family
*
Xanthomonas axonopodis pv. citri str. 306

Site:
position = -299
score = 6.75406
sequence = CGGTGTTATAGTTGAATACAACACCA

Gene: XAC1548: Transcriptional regulator, GntR family
*
Xanthomonas campestris pv. campestris str. ATCC 33913

Site:
position = -299
score = 6.32981
sequence = CGGTGTTATAGTTGAATACAAAACCA

Gene: XCC1500: Transcriptional regulator, GntR family
 
Xylella fastidiosa 9a5c
Transcriptional regulator, GntR family
XAC1547
 
Stenotrophomonas maltophilia K279a

Gene: Smlt3186: ABC transporter, ATP-binding protein
 
Xanthomonas axonopodis pv. citri str. 306

Gene: XAC1547: ABC transporter, ATP-binding protein
 
Xanthomonas campestris pv. campestris str. ATCC 33913

Gene: XCC1499: ABC transporter, ATP-binding protein
 
Xylella fastidiosa 9a5c

Gene: XF1602: ABC transporter, ATP-binding protein
ABC transporter, ATP-binding protein
XAC1546
 
Stenotrophomonas maltophilia K279a

Gene: Smlt3187: ABC transporter, permease protein
 
Xanthomonas axonopodis pv. citri str. 306

Gene: XAC1546: ABC transporter, permease protein
 
Xanthomonas campestris pv. campestris str. ATCC 33913

Gene: XCC1498: ABC transporter, permease protein
 
Xylella fastidiosa 9a5c

Gene: XF1601: ABC transporter, permease protein
ABC transporter, permease protein
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD