Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog EF1676 - Enterococcaceae

Properties
Regulator type: Transcription factor
Regulator family: GntR/Others
Regulation mode:
Biological process: Multidrug resistance; Multidrug efflux
Effector:
Phylum: Firmicutes
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 1 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Enterococcus faecalis V583 3 1
Enterococcus faecium DO
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
EF1676
*
Enterococcus faecalis V583

Site:
position = -46
score = 6.73415
sequence = TATAGTTAGTTACATAAGTAGTTAACCGTT

Gene: EF1676: Transcriptional regulator, GntR family
 
Enterococcus faecium DO
Transcriptional regulator, GntR family
lp_2743
 
Enterococcus faecalis V583

Gene: EF1675: ABC-type multidrug transport system, ATPase component
 
Enterococcus faecium DO
ABC-type multidrug transport system, ATPase component
lp_2744
 
Enterococcus faecalis V583

Gene: EF1674: ABC-type multidrug transport system, permease component
 
Enterococcus faecium DO
ABC-type multidrug transport system, permease component
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD