Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog CelR2 - Vibrionales

Properties
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Cellobiose utilization
Effector: Cellobiose-6-phosphate
Phylum: Proteobacteria/gamma
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 6 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Photobacterium profundum SS9
Vibrio angustum S14
Vibrio cholerae O1 biovar eltor str. N16961 2 1
Vibrio fischeri ES114 6 1
Vibrio harveyi ATCC BAA-1116
Vibrio parahaemolyticus RIMD 2210633
Vibrio salmonicida LFI1238 6 1
Vibrio shilonii AK1
Vibrio splendidus LGP32
Vibrio vulnificus CMCP6
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
celF
 
Photobacterium profundum SS9
 
Vibrio angustum S14
 
Vibrio cholerae O1 biovar eltor str. N16961
*
Vibrio fischeri ES114

Site:
position = -85
score = 6.25556
sequence = ATATGTAACCGGTTACTGAA

Site:
position = -72
score = 6.21413
sequence = TACTGAAACCGGTTACATTT

Gene: VF_0603: PTS system, cellobiose-specific IIC component (EC 2.7.1.69)
 
Vibrio harveyi ATCC BAA-1116
 
Vibrio parahaemolyticus RIMD 2210633
*
Vibrio salmonicida LFI1238

Site:
position = -71
score = 6.1202
sequence = TACTGAAACCGGTTACATTG

Site:
position = -84
score = 5.70852
sequence = GCGTGTAACCGGTTACTGAA

Gene: VSAL_I0703: PTS system, cellobiose-specific IIC component (EC 2.7.1.69)
 
Vibrio shilonii AK1
 
Vibrio splendidus LGP32
 
Vibrio vulnificus CMCP6
PTS system, cellobiose-specific IIC component (EC 2.7.1.69)
celE
 
Photobacterium profundum SS9
 
Vibrio angustum S14
 
Vibrio cholerae O1 biovar eltor str. N16961
 
Vibrio fischeri ES114

Gene: VF_0604: PTS system, cellobiose-specific IIB component (EC 2.7.1.69)
 
Vibrio harveyi ATCC BAA-1116
 
Vibrio parahaemolyticus RIMD 2210633
 
Vibrio salmonicida LFI1238

Gene: VSAL_I0704: PTS system, cellobiose-specific IIB component (EC 2.7.1.69)
 
Vibrio shilonii AK1
 
Vibrio splendidus LGP32
 
Vibrio vulnificus CMCP6
PTS system, cellobiose-specific IIB component (EC 2.7.1.69)
bglA
 
Photobacterium profundum SS9
 
Vibrio angustum S14
*
Vibrio cholerae O1 biovar eltor str. N16961

Site:
position = -97
score = 5.35814
sequence = TTCAGAAACTGGTTACATTG

Site:
position = -110
score = 6.56752
sequence = TTTTGTAACCGGTTTCAGAA

Gene: VC1558: 6-phospho-beta-glucosidase (EC 3.2.1.86)
 
Vibrio fischeri ES114

Gene: VF_0605: 6-phospho-beta-glucosidase (EC 3.2.1.86)
 
Vibrio harveyi ATCC BAA-1116
 
Vibrio parahaemolyticus RIMD 2210633
 
Vibrio salmonicida LFI1238

Gene: VSAL_I0705: 6-phospho-beta-glucosidase (EC 3.2.1.86)
 
Vibrio shilonii AK1
 
Vibrio splendidus LGP32
 
Vibrio vulnificus CMCP6
6-phospho-beta-glucosidase (EC 3.2.1.86)
glk
 
Photobacterium profundum SS9
 
Vibrio angustum S14
 
Vibrio cholerae O1 biovar eltor str. N16961
 
Vibrio fischeri ES114

Gene: VF_0606: Glucokinase, ROK family (EC 2.7.1.2)
 
Vibrio harveyi ATCC BAA-1116
 
Vibrio parahaemolyticus RIMD 2210633
 
Vibrio salmonicida LFI1238

Gene: VSAL_I0706: Glucokinase, ROK family (EC 2.7.1.2)
 
Vibrio shilonii AK1
 
Vibrio splendidus LGP32
 
Vibrio vulnificus CMCP6
Glucokinase, ROK family (EC 2.7.1.2)
celG
 
Photobacterium profundum SS9
 
Vibrio angustum S14
 
Vibrio cholerae O1 biovar eltor str. N16961
 
Vibrio fischeri ES114

Gene: VF_0607: PTS system, cellobiose-specific IIA component (EC 2.7.1.69)
 
Vibrio harveyi ATCC BAA-1116
 
Vibrio parahaemolyticus RIMD 2210633
 
Vibrio salmonicida LFI1238

Gene: VSAL_I0707: PTS system, cellobiose-specific IIA component (EC 2.7.1.69)
 
Vibrio shilonii AK1
 
Vibrio splendidus LGP32
 
Vibrio vulnificus CMCP6
PTS system, cellobiose-specific IIA component (EC 2.7.1.69)
celR2
 
Photobacterium profundum SS9
 
Vibrio angustum S14
 
Vibrio cholerae O1 biovar eltor str. N16961

Gene: VC1557: Transcriptional regulator for cellobiose utilization, LacI family
 
Vibrio fischeri ES114

Gene: VF_0608: Transcriptional regulator for cellobiose utilization, LacI family
 
Vibrio harveyi ATCC BAA-1116
 
Vibrio parahaemolyticus RIMD 2210633
 
Vibrio salmonicida LFI1238

Gene: VSAL_I0708: Transcriptional regulator for cellobiose utilization, LacI family
 
Vibrio shilonii AK1
 
Vibrio splendidus LGP32
 
Vibrio vulnificus CMCP6
Transcriptional regulator for cellobiose utilization, LacI family
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD