Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog AAur_2567 - Micrococcineae

Properties
Regulator type: Transcription factor
Regulator family: GntR/Others
Regulation mode:
Biological process: Multidrug resistance; Multidrug efflux
Effector:
Phylum: Actinobacteria
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 9 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Arthrobacter aurescens TC1 3 1
Arthrobacter chlorophenolicus A6 3 1
Arthrobacter sp. FB24
Beutenbergia cavernae DSM 12333 6 1
Brachybacterium faecium DSM 4810 3 1
Brevibacterium linens BL2 3 1
Clavibacter michiganensis subsp. michiganensis NCPPB 382
Janibacter sp. HTCC2649
Jonesia denitrificans DSM 20603 3 1
Kocuria rhizophila DC2201 3 1
Kytococcus sedentarius DSM 20547 3 1
Leifsonia xyli subsp. xyli str. CTCB07
Renibacterium salmoninarum ATCC 33209 1 1
Tropheryma whipplei str. Twist
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
AAur_2567
*
Arthrobacter aurescens TC1

Site:
position = -36
score = 7.00036
sequence = TATGGTTAGTTACATGAGTAATGAACCAGT

Gene: AAur_2567: Transcriptional regulator, GntR family
*
Arthrobacter chlorophenolicus A6

Site:
position = -48
score = 6.46099
sequence = CATGGTTAGTTAGTCAAGTAAGTAACCAAC

Gene: Achl_2889: Transcriptional regulator, GntR family
 
Arthrobacter sp. FB24
*
Beutenbergia cavernae DSM 12333

Site:
position = -48
score = 5.85161
sequence = CATGGTTCACTACTTACGTAATGAACCCCC

Gene: Bcav_0486: Transcriptional regulator, GntR family
*
Brachybacterium faecium DSM 4810

Site:
position = -66
score = 6.4492
sequence = CATGGTTCATTAGTGGAGTAATGAACCAAC

Gene: Bfae_06980: Transcriptional regulator, GntR family
*
Brevibacterium linens BL2

Site:
position = -45
score = 6.87521
sequence = CATGGTTAGTTAGTTGAGTAACTAACCAAC

Gene: BlinB01001376: Transcriptional regulator, GntR family
 
Clavibacter michiganensis subsp. michiganensis NCPPB 382
 
Janibacter sp. HTCC2649
*
Jonesia denitrificans DSM 20603

Site:
position = -36
score = 6.61921
sequence = ATAGGTTAGTTACATGAGTAATGAACCAGT

Gene: Jden_1559: Transcriptional regulator, GntR family
*
Kocuria rhizophila DC2201

Site:
position = -46
score = 5.99614
sequence = TGTGGTTCCTTAGTAAAGTAATGAACCAAG

Gene: KRH_20790: Transcriptional regulator, GntR family
*
Kytococcus sedentarius DSM 20547

Site:
position = -42
score = 6.8262
sequence = AATGGTTAGTTAGTCAAGTAACTAACTAAC

Gene: Ksed_02920: Transcriptional regulator, GntR family
 
Leifsonia xyli subsp. xyli str. CTCB07
*
Renibacterium salmoninarum ATCC 33209

Site:
position = -72
score = 5.69572
sequence = TTAGGTTAGTTGTATGAGTAATGAACCGGC

Gene: RSal33209_1480: Transcriptional regulator, GntR family
 
Tropheryma whipplei str. Twist
Transcriptional regulator, GntR family
lp_2743
 
Arthrobacter aurescens TC1

Gene: AAur_2566: ABC-type multidrug transport system, ATPase component
 
Arthrobacter chlorophenolicus A6

Gene: Achl_2888: ABC-type multidrug transport system, ATPase component
 
Arthrobacter sp. FB24
 
Beutenbergia cavernae DSM 12333

Gene: Bcav_0485: ABC-type multidrug transport system, ATPase component
 
Brachybacterium faecium DSM 4810

Gene: Bfae_06990: ABC-type multidrug transport system, ATPase component
 
Brevibacterium linens BL2

Gene: BlinB01001377: ABC-type multidrug transport system, ATPase component
 
Clavibacter michiganensis subsp. michiganensis NCPPB 382
 
Janibacter sp. HTCC2649
 
Jonesia denitrificans DSM 20603

Gene: Jden_1558: ABC-type multidrug transport system, ATPase component
 
Kocuria rhizophila DC2201

Gene: KRH_20780: ABC-type multidrug transport system, ATPase component
 
Kytococcus sedentarius DSM 20547

Gene: Ksed_02930: ABC-type multidrug transport system, ATPase component
 
Leifsonia xyli subsp. xyli str. CTCB07
 
Renibacterium salmoninarum ATCC 33209

Gene: RSal33209_1481: ABC-type multidrug transport system, ATPase component
 
Tropheryma whipplei str. Twist
ABC-type multidrug transport system, ATPase component
lp_2744
 
Arthrobacter aurescens TC1

Gene: AAur_2565: ABC-type multidrug transport system, permease component
 
Arthrobacter chlorophenolicus A6

Gene: Achl_2887: ABC-type multidrug transport system, permease component
 
Arthrobacter sp. FB24
 2
Beutenbergia cavernae DSM 12333

Gene: Bcav_0484: ABC-type multidrug transport system, permease component

Gene: Bcav_0483: ABC-type multidrug transport system, permease component
 
Brachybacterium faecium DSM 4810

Gene: Bfae_07000: ABC-type multidrug transport system, permease component
 
Brevibacterium linens BL2

Gene: BlinB01001378: ABC-type multidrug transport system, permease component
 
Clavibacter michiganensis subsp. michiganensis NCPPB 382
 
Janibacter sp. HTCC2649
 
Jonesia denitrificans DSM 20603

Gene: Jden_1557: ABC-type multidrug transport system, permease component
 
Kocuria rhizophila DC2201

Gene: KRH_20770: ABC-type multidrug transport system, permease component
 
Kytococcus sedentarius DSM 20547

Gene: Ksed_02940: ABC-type multidrug transport system, permease component
 
Leifsonia xyli subsp. xyli str. CTCB07
 
Renibacterium salmoninarum ATCC 33209

Gene: RSal33209_1482: ABC-type multidrug transport system, permease component
 
Tropheryma whipplei str. Twist
ABC-type multidrug transport system, permease component
Bcav_0482
 
Arthrobacter aurescens TC1
 
Arthrobacter chlorophenolicus A6
 
Arthrobacter sp. FB24
 
Beutenbergia cavernae DSM 12333

Gene: Bcav_0482: ABC transporter related
 
Brachybacterium faecium DSM 4810
 
Brevibacterium linens BL2
 
Clavibacter michiganensis subsp. michiganensis NCPPB 382
 
Janibacter sp. HTCC2649
 
Jonesia denitrificans DSM 20603
 
Kocuria rhizophila DC2201
 
Kytococcus sedentarius DSM 20547
 
Leifsonia xyli subsp. xyli str. CTCB07
 
Renibacterium salmoninarum ATCC 33209
 
Tropheryma whipplei str. Twist
ABC transporter related
Bcav_0481
 
Arthrobacter aurescens TC1
 
Arthrobacter chlorophenolicus A6
 
Arthrobacter sp. FB24
 
Beutenbergia cavernae DSM 12333

Gene: Bcav_0481: ABC-2 type transporter
 
Brachybacterium faecium DSM 4810
 
Brevibacterium linens BL2
 
Clavibacter michiganensis subsp. michiganensis NCPPB 382
 
Janibacter sp. HTCC2649
 
Jonesia denitrificans DSM 20603
 
Kocuria rhizophila DC2201
 
Kytococcus sedentarius DSM 20547
 
Leifsonia xyli subsp. xyli str. CTCB07
 
Renibacterium salmoninarum ATCC 33209
 
Tropheryma whipplei str. Twist
ABC-2 type transporter
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD