Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog Cg3261 - Corynebacteriaceae

Properties
Regulator type: Transcription factor
Regulator family: GntR/Others
Regulation mode:
Biological process: Multidrug resistance; Multidrug efflux
Effector:
Phylum: Actinobacteria
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 8 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Corynebacterium amycolatum SK46 3 1
Corynebacterium aurimucosum ATCC 700975 3 1
Corynebacterium diphtheriae NCTC 13129 3 1
Corynebacterium efficiens YS-314 1 1
Corynebacterium glutamicum ATCC 13032 1 1
Corynebacterium jeikeium K411 3 1
Corynebacterium kroppenstedtii DSM 44385
Corynebacterium urealyticum DSM 7109 6 2
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
lp_2742
*
Corynebacterium amycolatum SK46

Site:
position = -47
score = 3.8592
sequence = TTAGGTTTATGACATAGGTGGTATACCCGT

Gene: CORAM0001_0934: Transcriptional regulator, GntR family
*
Corynebacterium aurimucosum ATCC 700975

Site:
position = -42
score = 6.495
sequence = TATGGTTAGCTACATGAGTAACCAACCAGC

Gene: cauri_2429: Transcriptional regulator, GntR family
*
Corynebacterium diphtheriae NCTC 13129

Site:
position = -33
score = 7.01529
sequence = TATGGTTAGTTACATGAGTAACCAACCAAC

Gene: DIP2280: Transcriptional regulator, GntR family
*
Corynebacterium efficiens YS-314

Site:
position = -50
score = 6.50475
sequence = TAGGGTTAGTTACCTGAGTAACTAACCAAT

Gene: CE2809: Transcriptional regulator, GntR family
*
Corynebacterium glutamicum ATCC 13032

Site:
position = -39
score = 6.38365
sequence = TAGGGTTAGTTATATGAGTAACCAACCATC

Gene: cg3261: Transcriptional regulator, GntR family
*
Corynebacterium jeikeium K411

Site:
position = -109
score = 7.01529
sequence = TATGGTTAGTTACACAAGTAACCAACCAAC

Gene: jk0088: Transcriptional regulator, GntR family
 
Corynebacterium kroppenstedtii DSM 44385
*2
Corynebacterium urealyticum DSM 7109

Site:
position = -124
score = 6.80932
sequence = TATGGTTGGTTACACAAGTAACTAACCGAC

Gene: cur_0107: Transcriptional regulator, GntR family

Site:
position = -17
score = 3.45318
sequence = TTAGGTTTATGACCTACATGGTAAACCCCA

Gene: cur_1282: Transcriptional regulator, GntR family
Transcriptional regulator, GntR family
lp_2743
 
Corynebacterium amycolatum SK46

Gene: CORAM0001_0935: ABC-type multidrug transport system, ATPase component
 
Corynebacterium aurimucosum ATCC 700975

Gene: cauri_2428: ABC-type multidrug transport system, ATPase component
 
Corynebacterium diphtheriae NCTC 13129

Gene: DIP2279: ABC-type multidrug transport system, ATPase component
 
Corynebacterium efficiens YS-314
 
Corynebacterium glutamicum ATCC 13032
 
Corynebacterium jeikeium K411

Gene: jk0089: ABC-type multidrug transport system, ATPase component
 
Corynebacterium kroppenstedtii DSM 44385

Gene: ckrop_0085: ABC-type multidrug transport system, ATPase component
 2
Corynebacterium urealyticum DSM 7109

Gene: cur_0108: ABC-type multidrug transport system, ATPase component

Gene: cur_1281: ABC-type multidrug transport system, ATPase component
ABC-type multidrug transport system, ATPase component
lp_2744
 
Corynebacterium amycolatum SK46

Gene: CORAM0001_0936: ABC-type multidrug transport system, permease component
 
Corynebacterium aurimucosum ATCC 700975

Gene: cauri_2427: ABC-type multidrug transport system, permease component
 
Corynebacterium diphtheriae NCTC 13129

Gene: DIP2278: ABC-type multidrug transport system, permease component
 
Corynebacterium efficiens YS-314
 
Corynebacterium glutamicum ATCC 13032
 
Corynebacterium jeikeium K411

Gene: jk0090: ABC-type multidrug transport system, permease component
 
Corynebacterium kroppenstedtii DSM 44385

Gene: ckrop_0086: ABC-type multidrug transport system, permease component
 2
Corynebacterium urealyticum DSM 7109

Gene: cur_0109: ABC-type multidrug transport system, permease component

Gene: cur_1280: ABC-type multidrug transport system, permease component
ABC-type multidrug transport system, permease component
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD