Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog AAur_3503 - Micrococcineae

Properties
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Sugar utilization
Effector:
Phylum: Actinobacteria
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 4 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Clavibacter michiganensis subsp. michiganensis NCPPB 382
Arthrobacter aurescens TC1 5 1
Arthrobacter chlorophenolicus A6
Arthrobacter sp. FB24 6 1
Beutenbergia cavernae DSM 12333
Brachybacterium faecium DSM 4810
Brevibacterium linens BL2
Janibacter sp. HTCC2649
Jonesia denitrificans DSM 20603
Kocuria rhizophila DC2201
Tropheryma whipplei str. Twist
Renibacterium salmoninarum ATCC 33209
Leifsonia xyli subsp. xyli str. CTCB07
Kytococcus sedentarius DSM 20547
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
AAur_3501
 
Clavibacter michiganensis subsp. michiganensis NCPPB 382
*
Arthrobacter aurescens TC1

Site:
position = -163
score = 6.83358
sequence = CTTTGGAATCGATTCCACGG

Site:
position = -118
score = 6.58232
sequence = ATTTGGAATCGATTCCACGA

Gene: AAur_3501: Putative sugar ABC transporter, solute-binding domain protein
 
Arthrobacter chlorophenolicus A6
*
Arthrobacter sp. FB24

Site:
position = -162
score = 7.00979
sequence = CTTTGGAATCGATTCCACAG

Site:
position = -117
score = 7.00031
sequence = TTTTGGAATCGATTCCAAAA

Gene: Arth_3687: Putative sugar ABC transporter, solute-binding domain protein
 
Beutenbergia cavernae DSM 12333
 
Brachybacterium faecium DSM 4810
 
Brevibacterium linens BL2
 
Janibacter sp. HTCC2649
 
Jonesia denitrificans DSM 20603
 
Kocuria rhizophila DC2201
 
Tropheryma whipplei str. Twist
 
Renibacterium salmoninarum ATCC 33209
 
Leifsonia xyli subsp. xyli str. CTCB07
 
Kytococcus sedentarius DSM 20547
Putative sugar ABC transporter, solute-binding domain protein
Aaur_3500
 
Clavibacter michiganensis subsp. michiganensis NCPPB 382
 
Arthrobacter aurescens TC1

Gene: AAur_3500: Putative sugar ABC transporter, permease protein
 
Arthrobacter chlorophenolicus A6
 
Arthrobacter sp. FB24

Gene: Arth_3686: Putative sugar ABC transporter, permease protein
 
Beutenbergia cavernae DSM 12333
 
Brachybacterium faecium DSM 4810
 
Brevibacterium linens BL2
 
Janibacter sp. HTCC2649
 
Jonesia denitrificans DSM 20603
 
Kocuria rhizophila DC2201
 
Tropheryma whipplei str. Twist
 
Renibacterium salmoninarum ATCC 33209
 
Leifsonia xyli subsp. xyli str. CTCB07
 
Kytococcus sedentarius DSM 20547
Putative sugar ABC transporter, permease protein
Aaur_3499
 
Clavibacter michiganensis subsp. michiganensis NCPPB 382
 
Arthrobacter aurescens TC1

Gene: AAur_3499: Putative sugar ABC transporter, permease component
 
Arthrobacter chlorophenolicus A6
 
Arthrobacter sp. FB24

Gene: Arth_3685: Putative sugar ABC transporter, permease component
 
Beutenbergia cavernae DSM 12333
 
Brachybacterium faecium DSM 4810
 
Brevibacterium linens BL2
 
Janibacter sp. HTCC2649
 
Jonesia denitrificans DSM 20603
 
Kocuria rhizophila DC2201
 
Tropheryma whipplei str. Twist
 
Renibacterium salmoninarum ATCC 33209
 
Leifsonia xyli subsp. xyli str. CTCB07
 
Kytococcus sedentarius DSM 20547
Putative sugar ABC transporter, permease component
AAur_3498
 
Clavibacter michiganensis subsp. michiganensis NCPPB 382
 
Arthrobacter aurescens TC1

Gene: AAur_3498: putative sugar oxidoreductase
 
Arthrobacter chlorophenolicus A6
 
Arthrobacter sp. FB24

Gene: Arth_3684: putative sugar oxidoreductase
 
Beutenbergia cavernae DSM 12333
 
Brachybacterium faecium DSM 4810
 
Brevibacterium linens BL2
 
Janibacter sp. HTCC2649
 
Jonesia denitrificans DSM 20603
 
Kocuria rhizophila DC2201
 
Tropheryma whipplei str. Twist
 
Renibacterium salmoninarum ATCC 33209
 
Leifsonia xyli subsp. xyli str. CTCB07
 
Kytococcus sedentarius DSM 20547
putative sugar oxidoreductase
thuA
 
Clavibacter michiganensis subsp. michiganensis NCPPB 382
 
Arthrobacter aurescens TC1

Gene: AAur_3497: Trehalose utilization protein
 
Arthrobacter chlorophenolicus A6
 
Arthrobacter sp. FB24

Gene: Arth_3683: Trehalose utilization protein
 
Beutenbergia cavernae DSM 12333
 
Brachybacterium faecium DSM 4810
 
Brevibacterium linens BL2
 
Janibacter sp. HTCC2649
 
Jonesia denitrificans DSM 20603
 
Kocuria rhizophila DC2201
 
Tropheryma whipplei str. Twist
 
Renibacterium salmoninarum ATCC 33209
 
Leifsonia xyli subsp. xyli str. CTCB07
 
Kytococcus sedentarius DSM 20547
Trehalose utilization protein
AAur_0716
 
Clavibacter michiganensis subsp. michiganensis NCPPB 382
 
Arthrobacter aurescens TC1
 
Arthrobacter chlorophenolicus A6
 
Arthrobacter sp. FB24

Gene: Arth_3682: oxidoreductase domain protein
 
Beutenbergia cavernae DSM 12333
 
Brachybacterium faecium DSM 4810
 
Brevibacterium linens BL2
 
Janibacter sp. HTCC2649
 
Jonesia denitrificans DSM 20603
 
Kocuria rhizophila DC2201
 
Tropheryma whipplei str. Twist
 
Renibacterium salmoninarum ATCC 33209
 
Leifsonia xyli subsp. xyli str. CTCB07
 
Kytococcus sedentarius DSM 20547
putative myo-inositol 2-dehydrogenase
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD