Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog CelR3 - Vibrionales

Properties
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Cellobiose utilization
Effector: Cellobiose-6-phosphate
Phylum: Proteobacteria/gamma
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 3 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Photobacterium profundum SS9 4 1
Vibrio angustum S14
Vibrio vulnificus CMCP6
Vibrio splendidus LGP32
Vibrio shilonii AK1 4 2
Vibrio salmonicida LFI1238
Vibrio parahaemolyticus RIMD 2210633
Vibrio harveyi ATCC BAA-1116
Vibrio fischeri ES114
Vibrio cholerae O1 biovar eltor str. N16961
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
celB2
*
Photobacterium profundum SS9

Site:
position = -19
score = 6.04952
sequence = TACGGAAACCGGTTTCCATT

Gene: PBPRB2008: PTS system, cellobiose-specific IIB component (EC 2.7.1.69)
 
Vibrio angustum S14
 
Vibrio vulnificus CMCP6
 
Vibrio splendidus LGP32
*
Vibrio shilonii AK1

Site:
position = -73
score = 6.41242
sequence = TTTGGAAATCGGTTTCCAAA

Gene: VSAK1_16467: PTS system, cellobiose-specific IIB component (EC 2.7.1.69)
 
Vibrio salmonicida LFI1238
 
Vibrio parahaemolyticus RIMD 2210633
 
Vibrio harveyi ATCC BAA-1116
 
Vibrio fischeri ES114
 
Vibrio cholerae O1 biovar eltor str. N16961
PTS system, cellobiose-specific IIB component (EC 2.7.1.69)
celD2
 
Photobacterium profundum SS9

Gene: PBPRB2007: PTS system, cellobiose-specific IIC component (EC 2.7.1.69)
 
Vibrio angustum S14
 
Vibrio vulnificus CMCP6
 
Vibrio splendidus LGP32
 
Vibrio shilonii AK1

Gene: VSAK1_16472: PTS system, cellobiose-specific IIC component (EC 2.7.1.69)
 
Vibrio salmonicida LFI1238
 
Vibrio parahaemolyticus RIMD 2210633
 
Vibrio harveyi ATCC BAA-1116
 
Vibrio fischeri ES114
 
Vibrio cholerae O1 biovar eltor str. N16961
PTS system, cellobiose-specific IIC component (EC 2.7.1.69)
celH
 
Photobacterium profundum SS9

Gene: PBPRB2006: Beta-glucosidase (EC 3.2.1.21)
 
Vibrio angustum S14
 
Vibrio vulnificus CMCP6
 
Vibrio splendidus LGP32
 
Vibrio shilonii AK1
 
Vibrio salmonicida LFI1238
 
Vibrio parahaemolyticus RIMD 2210633
 
Vibrio harveyi ATCC BAA-1116
 
Vibrio fischeri ES114
 
Vibrio cholerae O1 biovar eltor str. N16961
Beta-glucosidase (EC 3.2.1.21)
celA2
 
Photobacterium profundum SS9

Gene: PBPRB2005: PTS system, cellobiose-specific IIA component (EC 2.7.1.69)
 
Vibrio angustum S14
 
Vibrio vulnificus CMCP6
 
Vibrio splendidus LGP32
 
Vibrio shilonii AK1

Gene: VSAK1_16477: PTS system, cellobiose-specific IIA component (EC 2.7.1.69)
 
Vibrio salmonicida LFI1238
 
Vibrio parahaemolyticus RIMD 2210633
 
Vibrio harveyi ATCC BAA-1116
 
Vibrio fischeri ES114
 
Vibrio cholerae O1 biovar eltor str. N16961
PTS system, cellobiose-specific IIA component (EC 2.7.1.69)
 
CRON 2.
celR3
 
Photobacterium profundum SS9

Gene: PBPRB2003: Transcriptional regulator of cellobiose utilization, LacI family
 
Vibrio angustum S14
 
Vibrio vulnificus CMCP6
 
Vibrio splendidus LGP32
*
Vibrio shilonii AK1

Site:
position = -56
score = 5.03062
sequence = TTTGGGAAACGGTTTCCCAA

Gene: VSAK1_16482: Transcriptional regulator of cellobiose utilization, LacI family
 
Vibrio salmonicida LFI1238
 
Vibrio parahaemolyticus RIMD 2210633
 
Vibrio harveyi ATCC BAA-1116
 
Vibrio fischeri ES114
 
Vibrio cholerae O1 biovar eltor str. N16961
Transcriptional regulator of cellobiose utilization, LacI family
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD