Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog ExuR - Clostridia-1

Properties
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Galacturonate utilization
Effector: Galacturonate
Phylum: Firmicutes
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 20 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Clostridium butyricum 5521 7 3
Clostridium perfringens ATCC 13124
Clostridium tetani E88
Clostridium novyi NT
Clostridium acetobutylicum ATCC 824 14 7
Clostridium beijerincki NCIMB 8052 4 1
Clostridium botulinum A str. ATCC 3502
Clostridium kluyveri DSM 555
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
pelX
*
Clostridium butyricum 5521

Site:
position = -34
score = 5.89225
sequence = AATTGTTAACGTTAACTATA

Site:
position = -122
score = 5.25241
sequence = AATTGTTAACGTTAAACTTA

Gene: CBY_2353: Exopolygalacturonate lyase
 
Clostridium perfringens ATCC 13124
 
Clostridium tetani E88
 
Clostridium novyi NT
 
Clostridium acetobutylicum ATCC 824
 
Clostridium beijerincki NCIMB 8052
 
Clostridium botulinum A str. ATCC 3502
 
Clostridium kluyveri DSM 555
Exopolygalacturonate lyase
 
CRON 2.
pelL
 
Clostridium butyricum 5521
 
Clostridium perfringens ATCC 13124
 
Clostridium tetani E88
 
Clostridium novyi NT
*
Clostridium acetobutylicum ATCC 824

Site:
position = -167
score = 5.66377
sequence = GTTTGTTAACGATAACAATA

Gene: CAC0812: Pectate transeliminase, secreted
 
Clostridium beijerincki NCIMB 8052
 
Clostridium botulinum A str. ATCC 3502
 
Clostridium kluyveri DSM 555
Pectate transeliminase, secreted
 
CRON 3.
rhiN
*
Clostridium butyricum 5521

Site:
position = -197
score = 4.4807
sequence = TTTGGAAAACGTGTTCAATT

Site:
position = -96
score = 4.9538
sequence = AAATGTGCACGTGTGCAAAA

Gene: CBY_0243: Rhamnogalacturonides degradation protein RhiN
 
Clostridium perfringens ATCC 13124
 
Clostridium tetani E88
 
Clostridium novyi NT
*
Clostridium acetobutylicum ATCC 824

Site:
position = -72
score = 5.71832
sequence = TATTGATAACGTGAACACTA

Site:
position = -195
score = 5.6835
sequence = CTTTGTTAACGTTAACGTAA

Gene: CAC0359: Rhamnogalacturonides degradation protein RhiN
 
Clostridium beijerincki NCIMB 8052
 
Clostridium botulinum A str. ATCC 3502
 
Clostridium kluyveri DSM 555
Rhamnogalacturonides degradation protein RhiN
PF02589
 
Clostridium butyricum 5521

Gene: CBY_0242: Domain of unknown function DUF162
 
Clostridium perfringens ATCC 13124
 
Clostridium tetani E88
 
Clostridium novyi NT
 
Clostridium acetobutylicum ATCC 824

Gene: CAC0356: Domain of unknown function DUF162
 
Clostridium beijerincki NCIMB 8052
 
Clostridium botulinum A str. ATCC 3502
 
Clostridium kluyveri DSM 555
Domain of unknown function DUF162
PF01522
 
Clostridium butyricum 5521

Gene: CBY_0241: Polysaccharide deacetylase
 
Clostridium perfringens ATCC 13124
 
Clostridium tetani E88
 
Clostridium novyi NT
 
Clostridium acetobutylicum ATCC 824

Gene: CAC0358: Polysaccharide deacetylase
 
Clostridium beijerincki NCIMB 8052
 
Clostridium botulinum A str. ATCC 3502
 
Clostridium kluyveri DSM 555
Polysaccharide deacetylase
rhiT
 
Clostridium butyricum 5521

Gene: CBY_0240: Putative rhamnogalacturonide transporter
 
Clostridium perfringens ATCC 13124
 
Clostridium tetani E88
 
Clostridium novyi NT
 
Clostridium acetobutylicum ATCC 824

Gene: CAC0357: Putative rhamnogalacturonide transporter
 
Clostridium beijerincki NCIMB 8052
 
Clostridium botulinum A str. ATCC 3502
 
Clostridium kluyveri DSM 555
Putative rhamnogalacturonide transporter
pgl
 
Clostridium butyricum 5521

Gene: CBY_0239: Polygalacturonase (EC 3.2.1.15)
 
Clostridium perfringens ATCC 13124
 
Clostridium tetani E88
 
Clostridium novyi NT
 
Clostridium acetobutylicum ATCC 824

Gene: CAC0355: Polygalacturonase (EC 3.2.1.15)
 
Clostridium beijerincki NCIMB 8052
 
Clostridium botulinum A str. ATCC 3502
 
Clostridium kluyveri DSM 555
Polygalacturonase (EC 3.2.1.15)
 
CRON 4.
mcp
 
Clostridium butyricum 5521
 
Clostridium perfringens ATCC 13124
 
Clostridium tetani E88
 
Clostridium novyi NT
*
Clostridium acetobutylicum ATCC 824

Site:
position = -51
score = 5.25059
sequence = TTTTGTTAACGTTATCTGTA

Site:
position = -38
score = 4.53584
sequence = ATCTGTATACGATAACAATT

Gene: CAC2774: Methyl-accepting chemotaxis protein with HAMP domain
 
Clostridium beijerincki NCIMB 8052
 
Clostridium botulinum A str. ATCC 3502
 
Clostridium kluyveri DSM 555
Methyl-accepting chemotaxis protein with HAMP domain
 
CRON 5.
pelA
 
Clostridium butyricum 5521
 
Clostridium perfringens ATCC 13124
 
Clostridium tetani E88
 
Clostridium novyi NT
*
Clostridium acetobutylicum ATCC 824

Site:
position = -100
score = 5.40849
sequence = AATTGTTAACGTTAAACAAA

Site:
position = -42
score = 4.5557
sequence = TATGTTTATCGTAAACAAAA

Site:
position = -106
score = 4.46398
sequence = TAATGTAATTGTTAACGTTA

Gene: CAC0804: Exopolygalacturonate lyase
 
Clostridium beijerincki NCIMB 8052
 
Clostridium botulinum A str. ATCC 3502
 
Clostridium kluyveri DSM 555
Exopolygalacturonate lyase
 
CRON 6.
pell
*
Clostridium butyricum 5521

Site:
position = -43
score = 5.95041
sequence = AATTGTTAACGATAACAATA

Gene: CBY_3715: Pectate lyase, secreted, polysaccharide lyase family
 
Clostridium perfringens ATCC 13124
 
Clostridium tetani E88
 
Clostridium novyi NT
*
Clostridium acetobutylicum ATCC 824

Site:
position = -46
score = 6.08787
sequence = AAATGTTAACGTTAACATAA

Gene: CAP0056: Pectate lyase, secreted, polysaccharide lyase family
 
Clostridium beijerincki NCIMB 8052
 
Clostridium botulinum A str. ATCC 3502
 
Clostridium kluyveri DSM 555
Pectate lyase, secreted, polysaccharide lyase family
 
CRON 7.
uxaC
 
Clostridium butyricum 5521
 
Clostridium perfringens ATCC 13124
 
Clostridium tetani E88
 
Clostridium novyi NT
*
Clostridium acetobutylicum ATCC 824

Site:
position = -121
score = 5.69303
sequence = AGTTGTTCACGTTCACAAAA

Gene: CAC0692: Uronate isomerase (EC 5.3.1.12)
*
Clostridium beijerincki NCIMB 8052

Site:
position = -148
score = 5.76116
sequence = AGTTGTTAACGTTCACAAAA

Site:
position = -71
score = 4.96276
sequence = AAATGTTCACGTGAACAGGG

Site:
position = -39
score = 6.36682
sequence = TTTTGTTCACGTGAACAAAA

Gene: Cbei_1832: Uronate isomerase (EC 5.3.1.12)
 
Clostridium botulinum A str. ATCC 3502
 
Clostridium kluyveri DSM 555
Uronate isomerase (EC 5.3.1.12)
uxaB
 
Clostridium butyricum 5521

Gene: CBY_0247: Altronate oxidoreductase (EC 1.1.1.58)
 
Clostridium perfringens ATCC 13124
 
Clostridium tetani E88
 
Clostridium novyi NT
*
Clostridium acetobutylicum ATCC 824

Site:
position = -42
score = 5.20613
sequence = TTTTGAACACGTGAACGTAA

Site:
position = -130
score = 5.41739
sequence = AAATGTTCACGTGTTCAAAA

Gene: CAC0695: Altronate oxidoreductase (EC 1.1.1.58)
 
Clostridium beijerincki NCIMB 8052

Gene: Cbei_1833: Altronate oxidoreductase (EC 1.1.1.58)
 
Clostridium botulinum A str. ATCC 3502
 
Clostridium kluyveri DSM 555
Altronate oxidoreductase (EC 1.1.1.58)
Cbei_4080
 
Clostridium butyricum 5521
 
Clostridium perfringens ATCC 13124
 
Clostridium tetani E88
 
Clostridium novyi NT
 
Clostridium acetobutylicum ATCC 824
 
Clostridium beijerincki NCIMB 8052

Gene: Cbei_1834: HIT family protein
 
Clostridium botulinum A str. ATCC 3502
 
Clostridium kluyveri DSM 555
HIT family protein
uxaT
 
Clostridium butyricum 5521
 
Clostridium perfringens ATCC 13124
 
Clostridium tetani E88
 
Clostridium novyi NT
 
Clostridium acetobutylicum ATCC 824

Gene: CAC0694: Galacturonate transporter UxaT
 
Clostridium beijerincki NCIMB 8052

Gene: Cbei_1835: Galacturonate transporter UxaT
 
Clostridium botulinum A str. ATCC 3502
 
Clostridium kluyveri DSM 555
Galacturonate transporter UxaT
exuR
 
Clostridium butyricum 5521

Gene: CBY_3741: Hexuronate utilization transcriptional repressor ExuR, LacI family
 
Clostridium perfringens ATCC 13124
 
Clostridium tetani E88
 
Clostridium novyi NT
 
Clostridium acetobutylicum ATCC 824

Gene: CAC0693: Hexuronate utilization transcriptional repressor ExuR, LacI family
 
Clostridium beijerincki NCIMB 8052

Gene: Cbei_1831: Hexuronate utilization transcriptional repressor ExuR, LacI family
 
Clostridium botulinum A str. ATCC 3502
 
Clostridium kluyveri DSM 555
Hexuronate utilization transcriptional repressor ExuR, LacI family
uxaA
 
Clostridium butyricum 5521

Gene: CBY_0246: Altronate hydrolase (EC 4.2.1.7)
 
Clostridium perfringens ATCC 13124
 
Clostridium tetani E88
 
Clostridium novyi NT
 
Clostridium acetobutylicum ATCC 824

Gene: CAC0696: Altronate hydrolase (EC 4.2.1.7)
 
Clostridium beijerincki NCIMB 8052
 
Clostridium botulinum A str. ATCC 3502
 
Clostridium kluyveri DSM 555
Altronate hydrolase (EC 4.2.1.7)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD