Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog BgaR - Micrococcineae

Properties
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Galactosides utilization
Effector: Beta-galactosides
Phylum: Actinobacteria
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 6 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Clavibacter michiganensis subsp. michiganensis NCPPB 382 5 2
Brevibacterium linens BL2
Brachybacterium faecium DSM 4810
Beutenbergia cavernae DSM 12333
Arthrobacter sp. FB24
Arthrobacter chlorophenolicus A6
Arthrobacter aurescens TC1
Janibacter sp. HTCC2649
Jonesia denitrificans DSM 20603 5 2
Kocuria rhizophila DC2201
Kytococcus sedentarius DSM 20547
Leifsonia xyli subsp. xyli str. CTCB07
Renibacterium salmoninarum ATCC 33209
Tropheryma whipplei str. Twist
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
bgaX
 
Clavibacter michiganensis subsp. michiganensis NCPPB 382

Gene: CMM_2699: Putative beta-galactoside ABC transport system, periplasmic component
 
Brevibacterium linens BL2
 
Brachybacterium faecium DSM 4810
 
Beutenbergia cavernae DSM 12333
 
Arthrobacter sp. FB24
 
Arthrobacter chlorophenolicus A6
 
Arthrobacter aurescens TC1
 
Janibacter sp. HTCC2649
*
Jonesia denitrificans DSM 20603

Site:
position = -175
score = 6.34263
sequence = CGATGTTTGCGTAAACATGC

Site:
position = -143
score = 6.49988
sequence = AGATGTTGACGTAAACATCG

Gene: Jden_0101: Putative beta-galactoside ABC transport system, periplasmic component
 
Kocuria rhizophila DC2201
 
Kytococcus sedentarius DSM 20547
 
Leifsonia xyli subsp. xyli str. CTCB07
 
Renibacterium salmoninarum ATCC 33209
 
Tropheryma whipplei str. Twist
Putative beta-galactoside ABC transport system, periplasmic component
bgaY
*
Clavibacter michiganensis subsp. michiganensis NCPPB 382

Site:
position = -94
score = 6.49988
sequence = AGATGTTTGCGCAAACACCC

Gene: CMM_2697: Putative beta-galactoside ABC transport system, permease component 2
 
Brevibacterium linens BL2
 
Brachybacterium faecium DSM 4810
 
Beutenbergia cavernae DSM 12333
 
Arthrobacter sp. FB24
 
Arthrobacter chlorophenolicus A6
 
Arthrobacter aurescens TC1
 
Janibacter sp. HTCC2649
 
Jonesia denitrificans DSM 20603

Gene: Jden_0102: Putative beta-galactoside ABC transport system, permease component 2
 
Kocuria rhizophila DC2201
 
Kytococcus sedentarius DSM 20547
 
Leifsonia xyli subsp. xyli str. CTCB07
 
Renibacterium salmoninarum ATCC 33209
 
Tropheryma whipplei str. Twist
Putative beta-galactoside ABC transport system, permease component 2
bgaZ
 
Clavibacter michiganensis subsp. michiganensis NCPPB 382

Gene: CMM_2698: Putative beta-galactoside ABC transport system, permease component 1
 
Brevibacterium linens BL2
 
Brachybacterium faecium DSM 4810
 
Beutenbergia cavernae DSM 12333
 
Arthrobacter sp. FB24
 
Arthrobacter chlorophenolicus A6
 
Arthrobacter aurescens TC1
 
Janibacter sp. HTCC2649
 
Jonesia denitrificans DSM 20603

Gene: Jden_0103: Putative beta-galactoside ABC transport system, permease component 1
 
Kocuria rhizophila DC2201
 
Kytococcus sedentarius DSM 20547
 
Leifsonia xyli subsp. xyli str. CTCB07
 
Renibacterium salmoninarum ATCC 33209
 
Tropheryma whipplei str. Twist
Putative beta-galactoside ABC transport system, permease component 1
bgaB
 
Clavibacter michiganensis subsp. michiganensis NCPPB 382

Gene: CMM_2700: Beta-galactosidase (EC 3.2.1.23)
 
Brevibacterium linens BL2
 
Brachybacterium faecium DSM 4810
 
Beutenbergia cavernae DSM 12333
 
Arthrobacter sp. FB24
 
Arthrobacter chlorophenolicus A6
 
Arthrobacter aurescens TC1
 
Janibacter sp. HTCC2649
 
Jonesia denitrificans DSM 20603

Gene: Jden_0104: Beta-galactosidase (EC 3.2.1.23)
 
Kocuria rhizophila DC2201
 
Kytococcus sedentarius DSM 20547
 
Leifsonia xyli subsp. xyli str. CTCB07
 
Renibacterium salmoninarum ATCC 33209
 
Tropheryma whipplei str. Twist
Beta-galactosidase (EC 3.2.1.23)
 
CRON 2.
bgaR
*
Clavibacter michiganensis subsp. michiganensis NCPPB 382

Site:
position = -2
score = 6.49988
sequence = GGGTGTTTGCGCAAACATCT

Gene: CMM_2696: Putative transcriptional regulator for beta-galactosides utilization, LacI family
 
Brevibacterium linens BL2
 
Brachybacterium faecium DSM 4810
 
Beutenbergia cavernae DSM 12333
 
Arthrobacter sp. FB24
 
Arthrobacter chlorophenolicus A6
 
Arthrobacter aurescens TC1
 
Janibacter sp. HTCC2649
*
Jonesia denitrificans DSM 20603

Site:
position = -143
score = 6.49988
sequence = CGATGTTTACGTCAACATCT

Site:
position = -111
score = 6.34263
sequence = GCATGTTTACGCAAACATCG

Gene: Jden_0100: Putative transcriptional regulator for beta-galactosides utilization, LacI family
 
Kocuria rhizophila DC2201
 
Kytococcus sedentarius DSM 20547
 
Leifsonia xyli subsp. xyli str. CTCB07
 
Renibacterium salmoninarum ATCC 33209
 
Tropheryma whipplei str. Twist
Putative transcriptional regulator for beta-galactosides utilization, LacI family
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD