Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog SgaR - Enterobacteriales

Properties
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Ascorbate utilization
Effector: Ascorbate-6-phosphate
Phylum: Proteobacteria/gamma
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 34 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Citrobacter koseri ATCC BAA-895 6 2
Edwardsiella tarda EIB202 4 2
Enterobacter sp. 638 6 2
Erwinia amylovora ATCC 49946
Erwinia carotovora subsp. atroseptica SCRI1043 5 2
Escherichia coli str. K-12 substr. MG1655
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 4 2
Photorhabdus luminescens subsp. laumondii TTO1 4 2
Proteus mirabilis HI4320 4 2
Salmonella typhimurium LT2 6 2
Serratia proteamaculans 568
Yersinia pestis KIM 2 2
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
sgaR
*
Citrobacter koseri ATCC BAA-895

Site:
position = -175
score = 6.11875
sequence = CAAAGATAGCGCTATCAAAA

Site:
position = -141
score = 6.2292
sequence = ATGTGATAGCGCTATCAAAA

Gene: CKO_00488: Ascorbate utilization transcriptional regulator SgaR, LacI family
*
Edwardsiella tarda EIB202

Site:
position = -242
score = 5.75003
sequence = CAATGGTAGCGCTATCTAGT

Site:
position = -208
score = 6.10249
sequence = TCGTGATAGCGCTATCATTT

Gene: ETAE_3025: Ascorbate utilization transcriptional regulator SgaR, LacI family
*
Enterobacter sp. 638

Site:
position = -161
score = 5.60848
sequence = CAAAGATAGCGCTACCAATC

Site:
position = -127
score = 6.2292
sequence = TTGTGATAGCGCTATCAAAT

Gene: Ent638_2847: Ascorbate utilization transcriptional regulator SgaR, LacI family
 
Erwinia amylovora ATCC 49946
*
Erwinia carotovora subsp. atroseptica SCRI1043

Site:
position = -228
score = 5.33971
sequence = AAAAGGTAGCGCTAACTGAT

Gene: ECA3772: Ascorbate utilization transcriptional regulator SgaR, LacI family
 
Escherichia coli str. K-12 substr. MG1655
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Site:
position = -138
score = 5.43145
sequence = CAAAGTTAGCGCTAACAAAG

Gene: KPN_01748: Ascorbate utilization transcriptional regulator SgaR, LacI family
*
Photorhabdus luminescens subsp. laumondii TTO1

Site:
position = -177
score = 6.16641
sequence = AAATGATAGCGCTATCTATG

Site:
position = -143
score = 6.26456
sequence = TTGTGATAGCGCTATCATTT

Gene: plu1978: Ascorbate utilization transcriptional regulator SgaR, LacI family
*
Proteus mirabilis HI4320

Site:
position = -171
score = 5.76389
sequence = TAATGGTAGCGCTATCTAGA

Site:
position = -137
score = 5.80258
sequence = TTGTGATAGCGCTATTATTT

Gene: PMI1778: Ascorbate utilization transcriptional regulator SgaR, LacI family
*
Salmonella typhimurium LT2

Site:
position = -141
score = 6.2292
sequence = TTGTGATAGCGCTATCAAAT

Site:
position = -175
score = 5.34693
sequence = CAAAGATAGCGCTACCAGCG

Gene: STM2345: Ascorbate utilization transcriptional regulator SgaR, LacI family
 
Serratia proteamaculans 568
*
Yersinia pestis KIM

Site:
position = -156
score = 6.26456
sequence = TTGTGATAGCGCTATCATTT

Site:
position = -177
score = 5.88118
sequence = ATCTGGTAGCGCTATCAAAA

Site:
position = -190
score = 5.85977
sequence = AATTGATAGCGCTATCTGGT

Gene: y1619: Ascorbate utilization transcriptional regulator SgaR, LacI family
Ascorbate utilization transcriptional regulator SgaR, LacI family
 
CRON 2.
sgaA
*
Citrobacter koseri ATCC BAA-895

Site:
position = -128
score = 6.11875
sequence = TTTTGATAGCGCTATCTTTG

Site:
position = -162
score = 6.2292
sequence = TTTTGATAGCGCTATCACAT

Gene: CKO_00489: Ascorbate-specific PTS system, EIIA component (EC 2.7.1.-)
*
Edwardsiella tarda EIB202

Site:
position = -122
score = 6.10249
sequence = AAATGATAGCGCTATCACGA

Site:
position = -88
score = 5.75003
sequence = ACTAGATAGCGCTACCATTG

Gene: ETAE_3026: Ascorbate-specific PTS system, EIIA component (EC 2.7.1.-)
*
Enterobacter sp. 638

Site:
position = -129
score = 6.2292
sequence = ATTTGATAGCGCTATCACAA

Site:
position = -95
score = 5.60848
sequence = GATTGGTAGCGCTATCTTTG

Gene: Ent638_2846: Ascorbate-specific PTS system, EIIA component (EC 2.7.1.-)
 
Erwinia amylovora ATCC 49946
*
Erwinia carotovora subsp. atroseptica SCRI1043

Site:
position = -91
score = 5.33971
sequence = ATCAGTTAGCGCTACCTTTT

Gene: ECA3773: Ascorbate-specific PTS system, EIIA component (EC 2.7.1.-)
 
Escherichia coli str. K-12 substr. MG1655
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Site:
position = -90
score = 5.43145
sequence = CTTTGTTAGCGCTAACTTTG

Gene: KPN_01747: Ascorbate-specific PTS system, EIIA component (EC 2.7.1.-)
*
Photorhabdus luminescens subsp. laumondii TTO1

Site:
position = -115
score = 6.26456
sequence = AAATGATAGCGCTATCACAA

Site:
position = -81
score = 6.16641
sequence = CATAGATAGCGCTATCATTT

Gene: plu1979: Ascorbate-specific PTS system, EIIA component (EC 2.7.1.-)
*
Proteus mirabilis HI4320

Site:
position = -75
score = 5.76389
sequence = TCTAGATAGCGCTACCATTA

Site:
position = -109
score = 5.80258
sequence = AAATAATAGCGCTATCACAA

Gene: PMI1777: Ascorbate-specific PTS system, EIIA component (EC 2.7.1.-)
*
Salmonella typhimurium LT2

Site:
position = -131
score = 6.2292
sequence = ATTTGATAGCGCTATCACAA

Site:
position = -97
score = 5.34693
sequence = CGCTGGTAGCGCTATCTTTG

Gene: STM2344: Ascorbate-specific PTS system, EIIA component (EC 2.7.1.-)
 
Serratia proteamaculans 568
*
Yersinia pestis KIM

Site:
position = -128
score = 6.26456
sequence = AAATGATAGCGCTATCACAA

Site:
position = -107
score = 5.88118
sequence = TTTTGATAGCGCTACCAGAT

Site:
position = -94
score = 5.85977
sequence = ACCAGATAGCGCTATCAATT

Gene: y1618: Ascorbate-specific PTS system, EIIA component (EC 2.7.1.-)
Ascorbate-specific PTS system, EIIA component (EC 2.7.1.-)
sgaB
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_00490: Ascorbate-specific PTS system, EIIB component (EC 2.7.1.69)
 
Edwardsiella tarda EIB202

Gene: ETAE_3027: Ascorbate-specific PTS system, EIIB component (EC 2.7.1.69)
 
Enterobacter sp. 638

Gene: Ent638_2845: Ascorbate-specific PTS system, EIIB component (EC 2.7.1.69)
 
Erwinia amylovora ATCC 49946
 
Erwinia carotovora subsp. atroseptica SCRI1043

Gene: ECA3774: Ascorbate-specific PTS system, EIIB component (EC 2.7.1.69)
 
Escherichia coli str. K-12 substr. MG1655
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_01746: Ascorbate-specific PTS system, EIIB component (EC 2.7.1.69)
 
Photorhabdus luminescens subsp. laumondii TTO1

Gene: plu1980: Ascorbate-specific PTS system, EIIB component (EC 2.7.1.69)
 
Proteus mirabilis HI4320

Gene: PMI1776: Ascorbate-specific PTS system, EIIB component (EC 2.7.1.69)
 
Salmonella typhimurium LT2

Gene: STM2343: Ascorbate-specific PTS system, EIIB component (EC 2.7.1.69)
 
Serratia proteamaculans 568
 
Yersinia pestis KIM
Ascorbate-specific PTS system, EIIB component (EC 2.7.1.69)
sgaT
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_00491: Ascorbate-specific PTS system, EIIC component
 
Edwardsiella tarda EIB202

Gene: ETAE_3028: Ascorbate-specific PTS system, EIIC component
 
Enterobacter sp. 638

Gene: Ent638_2844: Ascorbate-specific PTS system, EIIC component
 
Erwinia amylovora ATCC 49946
 
Erwinia carotovora subsp. atroseptica SCRI1043

Gene: ECA3775: Ascorbate-specific PTS system, EIIC component
 
Escherichia coli str. K-12 substr. MG1655
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_01745: Ascorbate-specific PTS system, EIIC component
 
Photorhabdus luminescens subsp. laumondii TTO1

Gene: plu1981: Ascorbate-specific PTS system, EIIC component
 
Proteus mirabilis HI4320

Gene: PMI1775: Ascorbate-specific PTS system, EIIC component
 
Salmonella typhimurium LT2

Gene: STM2342: Ascorbate-specific PTS system, EIIC component
 
Serratia proteamaculans 568
 
Yersinia pestis KIM

Gene: y1615: Ascorbate-specific PTS system, EIIC component
Ascorbate-specific PTS system, EIIC component
tktA
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_00492: Transketolase, N-terminal section (EC 2.2.1.1)
 
Edwardsiella tarda EIB202
 
Enterobacter sp. 638

Gene: Ent638_2843: Transketolase, N-terminal section (EC 2.2.1.1)
 
Erwinia amylovora ATCC 49946
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Escherichia coli str. K-12 substr. MG1655
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
 
Photorhabdus luminescens subsp. laumondii TTO1
 
Proteus mirabilis HI4320
 
Salmonella typhimurium LT2

Gene: STM2341: Transketolase, N-terminal section (EC 2.2.1.1)
 
Serratia proteamaculans 568
 
Yersinia pestis KIM
Transketolase, N-terminal section (EC 2.2.1.1)
tktB
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_00493: Transketolase, C-terminal section (EC 2.2.1.1)
 
Edwardsiella tarda EIB202
 
Enterobacter sp. 638

Gene: Ent638_2842: Transketolase, C-terminal section (EC 2.2.1.1)
 
Erwinia amylovora ATCC 49946
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Escherichia coli str. K-12 substr. MG1655
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
 
Photorhabdus luminescens subsp. laumondii TTO1
 
Proteus mirabilis HI4320
 
Salmonella typhimurium LT2

Gene: STM2340: Transketolase, C-terminal section (EC 2.2.1.1)
 
Serratia proteamaculans 568
 
Yersinia pestis KIM
Transketolase, C-terminal section (EC 2.2.1.1)
tal
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_02285: Transaldolase (EC 2.2.1.2)
 
Edwardsiella tarda EIB202

Gene: ETAE_0452: Transaldolase (EC 2.2.1.2)
 
Enterobacter sp. 638

Gene: Ent638_1319: Transaldolase (EC 2.2.1.2)
 
Erwinia amylovora ATCC 49946
 
Erwinia carotovora subsp. atroseptica SCRI1043

Gene: ECA3776: Transaldolase (EC 2.2.1.2)
 
Escherichia coli str. K-12 substr. MG1655

Gene: b0825: Transaldolase (EC 2.2.1.2)
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
 
Photorhabdus luminescens subsp. laumondii TTO1
 
Proteus mirabilis HI4320
 
Salmonella typhimurium LT2
 
Serratia proteamaculans 568

Gene: Spro_2640: Transaldolase (EC 2.2.1.2)
 
Yersinia pestis KIM

Gene: y2074: Transaldolase (EC 2.2.1.2)
Transaldolase (EC 2.2.1.2)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD