Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog BglR - Deinococcus-Thermus

Properties
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Beta-glucosides utilization
Effector: Beta-glucoside
Phylum: Deinococcus-Thermus
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 4 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Deinococcus deserti VCD115 5 1
Deinococcus geothermalis DSM 11300 5 2
Deinococcus radiodurans R1
Thermus aquaticus Y51MC23
Thermus thermophilus HB27 5 1
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
bglR
*
Deinococcus deserti VCD115

Site:
position = -90
score = 6.3397
sequence = TCTTGACAGCGCTTTCAAAA

Gene: Deide_00590: Transcriptional regulator for beta-glucoside utilization, LacI family
*
Deinococcus geothermalis DSM 11300

Site:
position = -31
score = 5.81734
sequence = TTTTGCAACCGCTTTCAGAT

Gene: Dgeo_2858: Transcriptional regulator for beta-glucoside utilization, LacI family
 
Deinococcus radiodurans R1
 
Thermus aquaticus Y51MC23
*
Thermus thermophilus HB27

Site:
position = -21
score = 6.31082
sequence = TCTTGCAAGCGCTTTCAACA

Gene: TTP0038: Transcriptional regulator for beta-glucoside utilization, LacI family
Transcriptional regulator for beta-glucoside utilization, LacI family
bglE
 
Deinococcus deserti VCD115

Gene: Deide_00580: Predicted beta-glucoside ABC transporter, periplasmic component
*
Deinococcus geothermalis DSM 11300

Site:
position = -147
score = 5.55305
sequence = GTTGACAAGCGCTTTCAAAG

Gene: Dgeo_2859: Predicted beta-glucoside ABC transporter, periplasmic component
 
Deinococcus radiodurans R1
 
Thermus aquaticus Y51MC23
 
Thermus thermophilus HB27

Gene: TTP0039: Predicted beta-glucoside ABC transporter, periplasmic component
Predicted beta-glucoside ABC transporter, periplasmic component
bglF
 
Deinococcus deserti VCD115

Gene: Deide_00570: Predicted beta-glucoside ABC transporter, permease component
 
Deinococcus geothermalis DSM 11300

Gene: Dgeo_2860: Predicted beta-glucoside ABC transporter, permease component
 
Deinococcus radiodurans R1
 
Thermus aquaticus Y51MC23
 
Thermus thermophilus HB27

Gene: TTP0040: Predicted beta-glucoside ABC transporter, permease component
Predicted beta-glucoside ABC transporter, permease component
bglG
 
Deinococcus deserti VCD115

Gene: Deide_00560: Predicted beta-glucoside ABC transporter, permease component
 
Deinococcus geothermalis DSM 11300

Gene: Dgeo_2861: Predicted beta-glucoside ABC transporter, permease component
 
Deinococcus radiodurans R1
 
Thermus aquaticus Y51MC23
 
Thermus thermophilus HB27

Gene: TTP0041: Predicted beta-glucoside ABC transporter, permease component
Predicted beta-glucoside ABC transporter, permease component
bglB
 
Deinococcus deserti VCD115

Gene: Deide_00550: Beta-glucosidase (EC 3.2.1.21)
 
Deinococcus geothermalis DSM 11300

Gene: Dgeo_2862: Beta-glucosidase (EC 3.2.1.21)
 
Deinococcus radiodurans R1
 
Thermus aquaticus Y51MC23
 
Thermus thermophilus HB27

Gene: TTP0042: Beta-glucosidase (EC 3.2.1.21)
Beta-glucosidase (EC 3.2.1.21)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD