Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog BglR - Vibrionales

Properties
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Beta-glucosides utilization
Effector: Beta-glucoside
Phylum: Proteobacteria/gamma
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 7 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Photobacterium profundum SS9
Vibrio angustum S14
Vibrio cholerae O1 biovar eltor str. N16961
Vibrio fischeri ES114
Vibrio harveyi ATCC BAA-1116 8 2
Vibrio parahaemolyticus RIMD 2210633
Vibrio salmonicida LFI1238
Vibrio shilonii AK1
Vibrio splendidus LGP32 8 2
Vibrio vulnificus CMCP6 7 2
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
bglR
 
Photobacterium profundum SS9
 
Vibrio angustum S14
 
Vibrio cholerae O1 biovar eltor str. N16961
 
Vibrio fischeri ES114
*
Vibrio harveyi ATCC BAA-1116

Site:
position = -60
score = 5.46461
sequence = CCATGAAAGCGGTTTCGGAG

Gene: VIBHAR_06943: Transcriptional regulator for beta-glucoside utilization, LacI family
 
Vibrio parahaemolyticus RIMD 2210633
 
Vibrio salmonicida LFI1238
 
Vibrio shilonii AK1
*
Vibrio splendidus LGP32

Site:
position = -41
score = 5.00469
sequence = TTTTGTAAGCGGTTACAAGC

Site:
position = -140
score = 5.65031
sequence = ATCTGTAAGCGCTTTCATGA

Gene: VS_II1392: Transcriptional regulator for beta-glucoside utilization, LacI family
*
Vibrio vulnificus CMCP6

Site:
position = -48
score = 5.57639
sequence = GCATGAAAGCGGTTTCGAAA

Gene: VV21282: Transcriptional regulator for beta-glucoside utilization, LacI family
Transcriptional regulator for beta-glucoside utilization, LacI family
bglE
 
Photobacterium profundum SS9
 
Vibrio angustum S14
 
Vibrio cholerae O1 biovar eltor str. N16961
 
Vibrio fischeri ES114
 2
Vibrio harveyi ATCC BAA-1116

Gene: VIBHAR_06941: Predicted beta-glucoside ABC transporter, periplasmic component

Gene: VIBHAR_06942: Predicted beta-glucoside ABC transporter, periplasmic component
 
Vibrio parahaemolyticus RIMD 2210633
 
Vibrio salmonicida LFI1238
 
Vibrio shilonii AK1
 
Vibrio splendidus LGP32

Gene: VS_II1391: Predicted beta-glucoside ABC transporter, periplasmic component
 
Vibrio vulnificus CMCP6

Gene: VV21283: Predicted beta-glucoside ABC transporter, periplasmic component
Predicted beta-glucoside ABC transporter, periplasmic component
bglF
 
Photobacterium profundum SS9
 
Vibrio angustum S14
 
Vibrio cholerae O1 biovar eltor str. N16961
 
Vibrio fischeri ES114
 
Vibrio harveyi ATCC BAA-1116

Gene: VIBHAR_06940: Predicted beta-glucoside ABC transporter, permease component
 
Vibrio parahaemolyticus RIMD 2210633
 
Vibrio salmonicida LFI1238
 
Vibrio shilonii AK1
 
Vibrio splendidus LGP32

Gene: VS_II1390: Predicted beta-glucoside ABC transporter, permease component
 
Vibrio vulnificus CMCP6

Gene: VV21284: Predicted beta-glucoside ABC transporter, permease component
Predicted beta-glucoside ABC transporter, permease component
bglG
 
Photobacterium profundum SS9
 
Vibrio angustum S14
 
Vibrio cholerae O1 biovar eltor str. N16961
 
Vibrio fischeri ES114
 
Vibrio harveyi ATCC BAA-1116

Gene: VIBHAR_06939: Predicted beta-glucoside ABC transporter, permease component
 
Vibrio parahaemolyticus RIMD 2210633
 
Vibrio salmonicida LFI1238
 
Vibrio shilonii AK1
 
Vibrio splendidus LGP32

Gene: VS_II1389: Predicted beta-glucoside ABC transporter, permease component
 
Vibrio vulnificus CMCP6

Gene: VV21286: Predicted beta-glucoside ABC transporter, permease component
Predicted beta-glucoside ABC transporter, permease component
bglB
 
Photobacterium profundum SS9
 
Vibrio angustum S14
 
Vibrio cholerae O1 biovar eltor str. N16961
 
Vibrio fischeri ES114
 
Vibrio harveyi ATCC BAA-1116

Gene: VIBHAR_06938: Beta-glucosidase (EC 3.2.1.21)
 
Vibrio parahaemolyticus RIMD 2210633
 
Vibrio salmonicida LFI1238
 
Vibrio shilonii AK1
 
Vibrio splendidus LGP32

Gene: VS_II1388: Beta-glucosidase (EC 3.2.1.21)
 
Vibrio vulnificus CMCP6

Gene: VV21287: Beta-glucosidase (EC 3.2.1.21)
Beta-glucosidase (EC 3.2.1.21)
bglK
 
Photobacterium profundum SS9
 
Vibrio angustum S14
 
Vibrio cholerae O1 biovar eltor str. N16961
 
Vibrio fischeri ES114
 
Vibrio harveyi ATCC BAA-1116

Gene: VIBHAR_06937: Predicted beta-glucoside ABC transporter, ATP-binding protein
 
Vibrio parahaemolyticus RIMD 2210633
 
Vibrio salmonicida LFI1238
 
Vibrio shilonii AK1
 
Vibrio splendidus LGP32

Gene: VS_II1387: Predicted beta-glucoside ABC transporter, ATP-binding protein
 
Vibrio vulnificus CMCP6

Gene: VV21288: Predicted beta-glucoside ABC transporter, ATP-binding protein
Predicted beta-glucoside ABC transporter, ATP-binding protein
VS_II1386
 
Photobacterium profundum SS9
 
Vibrio angustum S14
 
Vibrio cholerae O1 biovar eltor str. N16961
 
Vibrio fischeri ES114
 
Vibrio harveyi ATCC BAA-1116
 
Vibrio parahaemolyticus RIMD 2210633
 
Vibrio salmonicida LFI1238
 
Vibrio shilonii AK1
 
Vibrio splendidus LGP32

Gene: VS_II1386: Cellodextrin-phosphorylase (EC 2.4.1.49)
 
Vibrio vulnificus CMCP6
Cellodextrin-phosphorylase (EC 2.4.1.49)
 
CRON 2.
bglP
 
Photobacterium profundum SS9
 
Vibrio angustum S14
 
Vibrio cholerae O1 biovar eltor str. N16961
 
Vibrio fischeri ES114
*
Vibrio harveyi ATCC BAA-1116

Site:
position = -206
score = 6.1657
sequence = AAATGAAAGCGATTTCAAAT

Gene: VIBHAR_06946: Predicted porin for beta-glucosides
 
Vibrio parahaemolyticus RIMD 2210633
 
Vibrio salmonicida LFI1238
 
Vibrio shilonii AK1
*
Vibrio splendidus LGP32

Site:
position = -207
score = 5.94558
sequence = AAATGAAAGCGATTTCAAGC

Gene: VS_II1393: Predicted porin for beta-glucosides
*
Vibrio vulnificus CMCP6

Site:
position = -164
score = 6.04776
sequence = AAATGAAACCGATTTCAAAT

Gene: VV21281: Predicted porin for beta-glucosides
Predicted porin for beta-glucosides
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD