Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog RhiR - Enterobacteriales

Properties
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Rhamnogalacturonides utilization
Effector: Rhamogalacturonate oligosaccharides
Phylum: Proteobacteria/gamma
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 2 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Erwinia carotovora subsp. atroseptica SCRI1043 7 2
Enterobacter sp. 638
Erwinia amylovora ATCC 49946
Citrobacter koseri ATCC BAA-895
Edwardsiella tarda EIB202
Escherichia coli str. K-12 substr. MG1655
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
Photorhabdus luminescens subsp. laumondii TTO1
Proteus mirabilis HI4320
Salmonella typhimurium LT2
Serratia proteamaculans 568
Yersinia pestis KIM
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
rhiL
*
Erwinia carotovora subsp. atroseptica SCRI1043

Site:
position = -116
score = 7.36602
sequence = TTAATGCAAATTTGCATTAA

Gene: ECA3751: Putatuve rhamnogalacturonides ABC transporter, substrate-binding protein
 
Enterobacter sp. 638
 
Erwinia amylovora ATCC 49946
 
Citrobacter koseri ATCC BAA-895
 
Edwardsiella tarda EIB202
 
Escherichia coli str. K-12 substr. MG1655
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
 
Photorhabdus luminescens subsp. laumondii TTO1
 
Proteus mirabilis HI4320
 
Salmonella typhimurium LT2
 
Serratia proteamaculans 568
 
Yersinia pestis KIM
Putatuve rhamnogalacturonides ABC transporter, substrate-binding protein
 
CRON 2.
rhiX
*
Erwinia carotovora subsp. atroseptica SCRI1043

Site:
position = -152
score = 6.91744
sequence = TTAATGCAAATTTGCATTGT

Gene: ECA3750: hypothetical protein
 
Enterobacter sp. 638
 
Erwinia amylovora ATCC 49946
 
Citrobacter koseri ATCC BAA-895
 
Edwardsiella tarda EIB202
 
Escherichia coli str. K-12 substr. MG1655
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
 
Photorhabdus luminescens subsp. laumondii TTO1
 
Proteus mirabilis HI4320
 
Salmonella typhimurium LT2
 
Serratia proteamaculans 568
 
Yersinia pestis KIM
hypothetical protein
rhiN
 
Erwinia carotovora subsp. atroseptica SCRI1043

Gene: ECA3749: Rhamnogalacturonyl hydrolase (EC 3.2.1.172)
 
Enterobacter sp. 638
 
Erwinia amylovora ATCC 49946
 
Citrobacter koseri ATCC BAA-895
 
Edwardsiella tarda EIB202
 
Escherichia coli str. K-12 substr. MG1655
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
 
Photorhabdus luminescens subsp. laumondii TTO1
 
Proteus mirabilis HI4320
 
Salmonella typhimurium LT2
 
Serratia proteamaculans 568
 
Yersinia pestis KIM
Rhamnogalacturonyl hydrolase (EC 3.2.1.172)
rhiK
 
Erwinia carotovora subsp. atroseptica SCRI1043

Gene: ECA3748: Putatuve rhamnogalacturonides ABC transporter, ATP-binding protein
 
Enterobacter sp. 638
 
Erwinia amylovora ATCC 49946
 
Citrobacter koseri ATCC BAA-895
 
Edwardsiella tarda EIB202
 
Escherichia coli str. K-12 substr. MG1655
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
 
Photorhabdus luminescens subsp. laumondii TTO1
 
Proteus mirabilis HI4320
 
Salmonella typhimurium LT2
 
Serratia proteamaculans 568
 
Yersinia pestis KIM
Putatuve rhamnogalacturonides ABC transporter, ATP-binding protein
rhiG
 
Erwinia carotovora subsp. atroseptica SCRI1043

Gene: ECA3747: Putatuve rhamnogalacturonides ABC transporter, permease component 2
 
Enterobacter sp. 638
 
Erwinia amylovora ATCC 49946
 
Citrobacter koseri ATCC BAA-895
 
Edwardsiella tarda EIB202
 
Escherichia coli str. K-12 substr. MG1655
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
 
Photorhabdus luminescens subsp. laumondii TTO1
 
Proteus mirabilis HI4320
 
Salmonella typhimurium LT2
 
Serratia proteamaculans 568
 
Yersinia pestis KIM
Putatuve rhamnogalacturonides ABC transporter, permease component 2
rhiF
 
Erwinia carotovora subsp. atroseptica SCRI1043

Gene: ECA3746: Putatuve rhamnogalacturonides ABC transporter, permease component 1
 
Enterobacter sp. 638
 
Erwinia amylovora ATCC 49946
 
Citrobacter koseri ATCC BAA-895
 
Edwardsiella tarda EIB202
 
Escherichia coli str. K-12 substr. MG1655
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
 
Photorhabdus luminescens subsp. laumondii TTO1
 
Proteus mirabilis HI4320
 
Salmonella typhimurium LT2
 
Serratia proteamaculans 568
 
Yersinia pestis KIM
Putatuve rhamnogalacturonides ABC transporter, permease component 1
rhiR
 
Erwinia carotovora subsp. atroseptica SCRI1043

Gene: ECA3745: Predicted rhamnogalacturonides utilization transcriptional regulator, LacI family
 
Enterobacter sp. 638
 
Erwinia amylovora ATCC 49946
 
Citrobacter koseri ATCC BAA-895
 
Edwardsiella tarda EIB202
 
Escherichia coli str. K-12 substr. MG1655
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
 
Photorhabdus luminescens subsp. laumondii TTO1
 
Proteus mirabilis HI4320
 
Salmonella typhimurium LT2
 
Serratia proteamaculans 568
 
Yersinia pestis KIM
Predicted rhamnogalacturonides utilization transcriptional regulator, LacI family
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD