Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog CelR - Vibrionales

Properties
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Cellobiose utilization
Effector: Cellobiose-6-phosphate
Phylum: Proteobacteria/gamma
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 10 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Photobacterium profundum SS9 7 2
Vibrio angustum S14
Vibrio cholerae O1 biovar eltor str. N16961 7 2
Vibrio fischeri ES114
Vibrio harveyi ATCC BAA-1116 7 2
Vibrio parahaemolyticus RIMD 2210633 7 2
Vibrio salmonicida LFI1238
Vibrio shilonii AK1
Vibrio splendidus LGP32
Vibrio vulnificus CMCP6 7 2
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
celG
*
Photobacterium profundum SS9

Site:
position = -286
score = 6.40943
sequence = AAGCGCAACCGGTTGCGCGA

Gene: PBPRA0494: oligosaccharide deacetylase
 
Vibrio angustum S14
*
Vibrio cholerae O1 biovar eltor str. N16961

Site:
position = -179
score = 6.84134
sequence = AAGCGCAACCGGTTGCGTTA

Gene: VC1280: oligosaccharide deacetylase
 
Vibrio fischeri ES114
*
Vibrio harveyi ATCC BAA-1116

Site:
position = -184
score = 6.64276
sequence = AAGCGCAACCGGTTGCATTG

Gene: VIBHAR_03626: oligosaccharide deacetylase
*
Vibrio parahaemolyticus RIMD 2210633

Site:
position = -183
score = 6.95307
sequence = AAGCGCAACCGGTTGCGCTA

Gene: VP2638: oligosaccharide deacetylase
 
Vibrio salmonicida LFI1238
 
Vibrio shilonii AK1
 
Vibrio splendidus LGP32
*
Vibrio vulnificus CMCP6

Site:
position = -206
score = 6.64276
sequence = AAGCGCAACCGGTTGCATTG

Gene: VV1_1481: oligosaccharide deacetylase
oligosaccharide deacetylase
 
CRON 2.
celB
*
Photobacterium profundum SS9

Site:
position = -150
score = 6.73565
sequence = TCGCGCAACCGGTTGCGCTT

Gene: PBPRA0495: PTS system, cellobiose-specific IIB component (EC 2.7.1.69)
 
Vibrio angustum S14
*
Vibrio cholerae O1 biovar eltor str. N16961

Site:
position = -83
score = 6.93866
sequence = TAACGCAACCGGTTGCGCTT

Gene: VC1281: PTS system, cellobiose-specific IIB component (EC 2.7.1.69)
 
Vibrio fischeri ES114
*
Vibrio harveyi ATCC BAA-1116

Site:
position = -84
score = 6.67895
sequence = CAATGCAACCGGTTGCGCTT

Gene: VIBHAR_03625: PTS system, cellobiose-specific IIB component (EC 2.7.1.69)
*
Vibrio parahaemolyticus RIMD 2210633

Site:
position = -84
score = 7.05039
sequence = TAGCGCAACCGGTTGCGCTT

Gene: VP2637: PTS system, cellobiose-specific IIB component (EC 2.7.1.69)
 
Vibrio salmonicida LFI1238
 
Vibrio shilonii AK1
 
Vibrio splendidus LGP32
*
Vibrio vulnificus CMCP6

Site:
position = -127
score = 6.67895
sequence = CAATGCAACCGGTTGCGCTT

Gene: VV1_1482: PTS system, cellobiose-specific IIB component (EC 2.7.1.69)
PTS system, cellobiose-specific IIB component (EC 2.7.1.69)
celD
 
Photobacterium profundum SS9

Gene: PBPRA0496: PTS system, cellobiose-specific IIC component (EC 2.7.1.69)
 
Vibrio angustum S14
 
Vibrio cholerae O1 biovar eltor str. N16961

Gene: VC1282: PTS system, cellobiose-specific IIC component (EC 2.7.1.69)
 
Vibrio fischeri ES114
 
Vibrio harveyi ATCC BAA-1116

Gene: VIBHAR_03624: PTS system, cellobiose-specific IIC component (EC 2.7.1.69)
 
Vibrio parahaemolyticus RIMD 2210633

Gene: VP2636: PTS system, cellobiose-specific IIC component (EC 2.7.1.69)
 
Vibrio salmonicida LFI1238
 
Vibrio shilonii AK1
 
Vibrio splendidus LGP32
 
Vibrio vulnificus CMCP6

Gene: VV1_1483: PTS system, cellobiose-specific IIC component (EC 2.7.1.69)
PTS system, cellobiose-specific IIC component (EC 2.7.1.69)
celA
 
Photobacterium profundum SS9
 
Vibrio angustum S14
 
Vibrio cholerae O1 biovar eltor str. N16961

Gene: VC1283: PTS system, cellobiose-specific IIA component (EC 2.7.1.69)
 
Vibrio fischeri ES114
 
Vibrio harveyi ATCC BAA-1116

Gene: VIBHAR_03623: PTS system, cellobiose-specific IIA component (EC 2.7.1.69)
 
Vibrio parahaemolyticus RIMD 2210633

Gene: VP2635: PTS system, cellobiose-specific IIA component (EC 2.7.1.69)
 
Vibrio salmonicida LFI1238
 
Vibrio shilonii AK1
 
Vibrio splendidus LGP32
 
Vibrio vulnificus CMCP6

Gene: VV1_1484: PTS system, cellobiose-specific IIA component (EC 2.7.1.69)
PTS system, cellobiose-specific IIA component (EC 2.7.1.69)
bglA
 
Photobacterium profundum SS9

Gene: PBPRA0497: 6-phospho-beta-glucosidase (EC 3.2.1.86)
 
Vibrio angustum S14
 
Vibrio cholerae O1 biovar eltor str. N16961

Gene: VC1284: 6-phospho-beta-glucosidase (EC 3.2.1.86)
 
Vibrio fischeri ES114
 
Vibrio harveyi ATCC BAA-1116

Gene: VIBHAR_03622: 6-phospho-beta-glucosidase (EC 3.2.1.86)
 
Vibrio parahaemolyticus RIMD 2210633

Gene: VP2634: 6-phospho-beta-glucosidase (EC 3.2.1.86)
 
Vibrio salmonicida LFI1238
 
Vibrio shilonii AK1
 
Vibrio splendidus LGP32
 
Vibrio vulnificus CMCP6

Gene: VV1_1485: 6-phospho-beta-glucosidase (EC 3.2.1.86)
6-phospho-beta-glucosidase (EC 3.2.1.86)
celE
 
Photobacterium profundum SS9

Gene: PBPRA0498: Cellobiose phosphotransferase system YdjC-like protein
 
Vibrio angustum S14
 
Vibrio cholerae O1 biovar eltor str. N16961

Gene: VC1285: Cellobiose phosphotransferase system YdjC-like protein
 
Vibrio fischeri ES114
 
Vibrio harveyi ATCC BAA-1116

Gene: VIBHAR_03621: Cellobiose phosphotransferase system YdjC-like protein
 
Vibrio parahaemolyticus RIMD 2210633

Gene: VP2633: Cellobiose phosphotransferase system YdjC-like protein
 
Vibrio salmonicida LFI1238
 
Vibrio shilonii AK1
 
Vibrio splendidus LGP32
 
Vibrio vulnificus CMCP6

Gene: VV1_1486: Cellobiose phosphotransferase system YdjC-like protein
Cellobiose phosphotransferase system YdjC-like protein
celR
 2
Photobacterium profundum SS9

Gene: PBPRA0499: Transcriptional regulator for cellobiose utilization, LacI family

Gene: PBPRA0500: Transcriptional regulator for cellobiose utilization, LacI family
 
Vibrio angustum S14
 
Vibrio cholerae O1 biovar eltor str. N16961

Gene: VC1286: Transcriptional regulator for cellobiose utilization, LacI family
 
Vibrio fischeri ES114
 
Vibrio harveyi ATCC BAA-1116

Gene: VIBHAR_03620: Transcriptional regulator for cellobiose utilization, LacI family
 
Vibrio parahaemolyticus RIMD 2210633

Gene: VP2632: Transcriptional regulator for cellobiose utilization, LacI family
 
Vibrio salmonicida LFI1238
 
Vibrio shilonii AK1
 
Vibrio splendidus LGP32
 
Vibrio vulnificus CMCP6

Gene: VV1_1487: Transcriptional regulator for cellobiose utilization, LacI family
Transcriptional regulator for cellobiose utilization, LacI family
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD