Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog DR2501 - Deinococcus-Thermus

Properties
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Sugar utilization
Effector:
Phylum: Deinococcus-Thermus
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 8 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Deinococcus deserti VCD115 3 2
Deinococcus geothermalis DSM 11300 4 3
Deinococcus radiodurans R1 3 3
Thermus aquaticus Y51MC23
Thermus thermophilus HB27
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
DR2502
*
Deinococcus deserti VCD115

Site:
position = -51
score = 6.47163
sequence = GATCTGAAACGTTTCAGATC

Gene: Deide_01350: Predicted sugar permease, MFS family
*
Deinococcus geothermalis DSM 11300

Site:
position = -55
score = 5.85885
sequence = GATCTAAATCGATTTAGCCT

Gene: Dgeo_2244: Predicted sugar permease, MFS family
*
Deinococcus radiodurans R1

Site:
position = 70
score = 5.96196
sequence = CAACTGAAACGATTCAGTCT

Gene: DR2502: Predicted sugar permease, MFS family
 
Thermus aquaticus Y51MC23
 
Thermus thermophilus HB27
Predicted sugar permease, MFS family
 
CRON 2.
DR2501
*
Deinococcus deserti VCD115

Site:
position = -124
score = 6.47163
sequence = GATCTGAAACGTTTCAGATC

Gene: Deide_01360: Predicted sugar utilization transcriptional regulator, LacI family
*
Deinococcus geothermalis DSM 11300

Site:
position = -46
score = 5.85885
sequence = AGGCTAAATCGATTTAGATC

Gene: Dgeo_2243: Predicted sugar utilization transcriptional regulator, LacI family
*
Deinococcus radiodurans R1

Site:
position = -43
score = 5.96196
sequence = AGACTGAATCGTTTCAGTTG

Gene: DR2501: Predicted sugar utilization transcriptional regulator, LacI family
 
Thermus aquaticus Y51MC23
 
Thermus thermophilus HB27
Predicted sugar utilization transcriptional regulator, LacI family
galE
 
Deinococcus deserti VCD115

Gene: Deide_01370: UDP-glucose 4-epimerase (EC 5.1.3.2)
 
Deinococcus geothermalis DSM 11300

Gene: Dgeo_2242: UDP-glucose 4-epimerase (EC 5.1.3.2)
 
Deinococcus radiodurans R1

Gene: DR2202: UDP-glucose 4-epimerase (EC 5.1.3.2)
 
Thermus aquaticus Y51MC23
 
Thermus thermophilus HB27
UDP-glucose 4-epimerase (EC 5.1.3.2)
 
CRON 3.
aglA
 
Deinococcus deserti VCD115

Gene: Deide_08450: putative alpha-glucosidase (EC 3.2.1.20)
*
Deinococcus geothermalis DSM 11300

Site:
position = -47
score = 6.03182
sequence = GAACTGAATCGATTCAGTCG

Gene: Dgeo_0672: putative alpha-glucosidase (EC 3.2.1.20)
*
Deinococcus radiodurans R1

Site:
position = 55
score = 6.10168
sequence = CATCTGAAACGATTCAGTCC

Gene: DR1375: putative alpha-glucosidase (EC 3.2.1.20)
 
Thermus aquaticus Y51MC23

Gene: TaqDRAFT_4524: putative alpha-glucosidase (EC 3.2.1.20)
 
Thermus thermophilus HB27

Gene: TTC0107: putative alpha-glucosidase (EC 3.2.1.20)
putative alpha-glucosidase (EC 3.2.1.20)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD