Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog TreR - Alteromonadales

Properties
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Trehalose utilization
Effector: Trehalose
Phylum: Proteobacteria/gamma
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 16 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Alteromonadales bacterium TW-7
Alteromonas macleodii 'Deep ecotype'
Glaciecola sp. HTCC2999
Colwellia psychrerythraea 34H 5 4
Idiomarina baltica OS145
Idiomarina loihiensis L2TR
Pseudoalteromonas atlantica T6c 4 3
Pseudoalteromonas haloplanktis TAC125
Pseudoalteromonas tunicata D2 4 3
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
treP
 
Alteromonadales bacterium TW-7
 
Alteromonas macleodii 'Deep ecotype'
 
Glaciecola sp. HTCC2999
*
Colwellia psychrerythraea 34H

Site:
position = -133
score = 4.83573
sequence = AAACACTATCGATTGCATAT

Site:
position = -76
score = 6.41072
sequence = TTTTGCAAACGATTGCATAA

Gene: CPS_0980: Trehalose phosphorylase (EC 2.4.1.64)
 
Idiomarina baltica OS145
 
Idiomarina loihiensis L2TR
 
Pseudoalteromonas atlantica T6c
 
Pseudoalteromonas haloplanktis TAC125
 
Pseudoalteromonas tunicata D2
Trehalose phosphorylase (EC 2.4.1.64)
pgm2
 
Alteromonadales bacterium TW-7
 
Alteromonas macleodii 'Deep ecotype'
 
Glaciecola sp. HTCC2999
 
Colwellia psychrerythraea 34H

Gene: CPS_0979: Beta-phosphoglucomutase (EC 5.4.2.6)
 
Idiomarina baltica OS145
 
Idiomarina loihiensis L2TR
 
Pseudoalteromonas atlantica T6c
 
Pseudoalteromonas haloplanktis TAC125
 
Pseudoalteromonas tunicata D2
Beta-phosphoglucomutase (EC 5.4.2.6)
 
CRON 2.
treR
 
Alteromonadales bacterium TW-7
 
Alteromonas macleodii 'Deep ecotype'
 
Glaciecola sp. HTCC2999
*
Colwellia psychrerythraea 34H

Site:
position = -94
score = 6.11775
sequence = TAATGCAATCGATTGCAAGG

Site:
position = -71
score = 5.9052
sequence = TTTTACAATCGATTGCATTG

Gene: CPS_0978: Transcriptional regulator of trehalose utilization, LacI family
 
Idiomarina baltica OS145
 
Idiomarina loihiensis L2TR
*
Pseudoalteromonas atlantica T6c

Site:
position = -381
score = 6.41151
sequence = AAATGCAAACGATTGCAATT

Site:
position = -357
score = 6.41112
sequence = TTTTGCAATCGTTTGCATTT

Gene: Patl_1823: Transcriptional regulator of trehalose utilization, LacI family
 
Pseudoalteromonas haloplanktis TAC125
*
Pseudoalteromonas tunicata D2

Site:
position = -165
score = 6.41112
sequence = TTATGCAAACGTTTGCAATT

Gene: PTD2_20307: Transcriptional regulator of trehalose utilization, LacI family
Transcriptional regulator of trehalose utilization, LacI family
 
CRON 3.
treT
 
Alteromonadales bacterium TW-7
 
Alteromonas macleodii 'Deep ecotype'
 
Glaciecola sp. HTCC2999
*
Colwellia psychrerythraea 34H

Site:
position = -94
score = 4.83573
sequence = ATATGCAATCGATAGTGTTT

Site:
position = -151
score = 6.41072
sequence = TTATGCAATCGTTTGCAAAA

Gene: CPS_0981: Predicted trehalose permease, MFS family, FucP subfamily
 
Idiomarina baltica OS145
 
Idiomarina loihiensis L2TR
*
Pseudoalteromonas atlantica T6c

Site:
position = -73
score = 6.21623
sequence = GAATGCAAACGATTGCATTT

Gene: Patl_1824: Predicted trehalose permease, MFS family, FucP subfamily
 
Pseudoalteromonas haloplanktis TAC125
*
Pseudoalteromonas tunicata D2

Site:
position = -113
score = 6.41151
sequence = AAATGCAAACGTTTGCATTT

Gene: PTD2_20312: Predicted trehalose permease, MFS family, FucP subfamily
Predicted trehalose permease, MFS family, FucP subfamily
treF
 
Alteromonadales bacterium TW-7
 
Alteromonas macleodii 'Deep ecotype'
 
Glaciecola sp. HTCC2999
 
Colwellia psychrerythraea 34H
 
Idiomarina baltica OS145
 
Idiomarina loihiensis L2TR
 
Pseudoalteromonas atlantica T6c

Gene: Patl_1825: Trehalase (EC 3.2.1.28)
 
Pseudoalteromonas haloplanktis TAC125
 
Pseudoalteromonas tunicata D2

Gene: PTD2_20317: Trehalase (EC 3.2.1.28)
Trehalase (EC 3.2.1.28)
 
CRON 4.
omp(Tre)
 
Alteromonadales bacterium TW-7
 
Alteromonas macleodii 'Deep ecotype'
 
Glaciecola sp. HTCC2999
*
Colwellia psychrerythraea 34H

Site:
position = -142
score = 5.9052
sequence = CAATGCAATCGATTGTAAAA

Site:
position = -119
score = 6.11775
sequence = CCTTGCAATCGATTGCATTA

Gene: CPS_0977: Trehalose-regulated TonB-dependent outer membrane receptor
 
Idiomarina baltica OS145
 
Idiomarina loihiensis L2TR
*
Pseudoalteromonas atlantica T6c

Site:
position = -64
score = 6.41151
sequence = AATTGCAATCGTTTGCATTT

Site:
position = -88
score = 6.41112
sequence = AAATGCAAACGATTGCAAAA

Gene: Patl_1822: Trehalose-regulated TonB-dependent outer membrane receptor
 
Pseudoalteromonas haloplanktis TAC125
*
Pseudoalteromonas tunicata D2

Site:
position = -124
score = 6.41112
sequence = AATTGCAAACGTTTGCATAA

Gene: PTD2_20302: Trehalose-regulated TonB-dependent outer membrane receptor
Trehalose-regulated TonB-dependent outer membrane receptor
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD