Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog FruR2 - Ralstonia

Properties
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Fructose utilization
Effector: Fructose-1-phosphate
Phylum: Proteobacteria/beta
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 8 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Ralstonia solanacearum GMI1000 4 2
Ralstonia pickettii 12J 4 2
Ralstonia metallidurans CH34
Ralstonia eutropha JMP134
Ralstonia eutropha H16
Cupriavidus taiwanensis
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
fruR2
*
Ralstonia solanacearum GMI1000

Site:
position = -20
score = 5.44986
sequence = CTTTGGAAACGATTTCAGCG

Site:
position = -163
score = 6.18685
sequence = GATTGAAATCGATTACATTG

Gene: RSc2860: Transcriptional regulator for fructose utilization, LacI family
*
Ralstonia pickettii 12J

Site:
position = -153
score = 6.62804
sequence = AATTGAAATCGATTACAGTT

Site:
position = -19
score = 5.04343
sequence = CTTTGGAAACGATTTCAGCA

Gene: Rpic_3107: Transcriptional regulator for fructose utilization, LacI family
 
Ralstonia metallidurans CH34
 
Ralstonia eutropha JMP134
 
Ralstonia eutropha H16
 
Cupriavidus taiwanensis
Transcriptional regulator for fructose utilization, LacI family
 
CRON 2.
fruB
*
Ralstonia solanacearum GMI1000

Site:
position = -83
score = 6.18685
sequence = CAATGTAATCGATTTCAATC

Site:
position = -226
score = 5.44986
sequence = CGCTGAAATCGTTTCCAAAG

Gene: RSc2861: PTS system, fructose-specific IIA component (EC 2.7.1.69) / Phosphotransferase system, phosphocarrier protein HPr / Phosphoenolpyruvate-protein phosphotransferase of PTS system (EC 2.7.3.9)
*
Ralstonia pickettii 12J

Site:
position = -218
score = 5.04343
sequence = TGCTGAAATCGTTTCCAAAG

Site:
position = -84
score = 6.62804
sequence = AACTGTAATCGATTTCAATT

Gene: Rpic_3108: PTS system, fructose-specific IIA component (EC 2.7.1.69) / Phosphotransferase system, phosphocarrier protein HPr / Phosphoenolpyruvate-protein phosphotransferase of PTS system (EC 2.7.3.9)
 
Ralstonia metallidurans CH34
 
Ralstonia eutropha JMP134
 
Ralstonia eutropha H16
 
Cupriavidus taiwanensis
PTS system, fructose-specific IIA component (EC 2.7.1.69) / Phosphotransferase system, phosphocarrier protein HPr / Phosphoenolpyruvate-protein phosphotransferase of PTS system (EC 2.7.3.9)
fruK
 
Ralstonia solanacearum GMI1000

Gene: RSc2862: 1-phosphofructokinase (EC 2.7.1.56)
 
Ralstonia pickettii 12J

Gene: Rpic_3109: 1-phosphofructokinase (EC 2.7.1.56)
 
Ralstonia metallidurans CH34
 
Ralstonia eutropha JMP134
 
Ralstonia eutropha H16
 
Cupriavidus taiwanensis
1-phosphofructokinase (EC 2.7.1.56)
fruA
 
Ralstonia solanacearum GMI1000

Gene: RSc2863: PTS system, fructose-specific IIB component (EC 2.7.1.69) / PTS system, fructose-specific IIC component (EC 2.7.1.69)
 
Ralstonia pickettii 12J

Gene: Rpic_3110: PTS system, fructose-specific IIB component (EC 2.7.1.69) / PTS system, fructose-specific IIC component (EC 2.7.1.69)
 
Ralstonia metallidurans CH34
 
Ralstonia eutropha JMP134
 
Ralstonia eutropha H16
 
Cupriavidus taiwanensis
PTS system, fructose-specific IIB component (EC 2.7.1.69) / PTS system, fructose-specific IIC component (EC 2.7.1.69)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD