Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog ScrR2 - Bacillales

Properties
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Sucrose utilization
Effector: Sucrose-6-phosphate
Phylum: Firmicutes
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 5 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Anoxybacillus flavithermus WK1
Bacillus amyloliquefaciens FZB42
Bacillus cereus ATCC 14579 3 1
Bacillus clausii KSM-K16 2 1
Bacillus halodurans C-125 3 1
Bacillus licheniformis DSM 13
Bacillus pumilus SAFR-032
Bacillus subtilis subsp. subtilis str. 168
Geobacillus kaustophilus HTA426
Oceanobacillus iheyensis HTE831
Paenibacillus sp. JDR-2
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
scrA
 
Anoxybacillus flavithermus WK1

Gene: Aflv_2785: Sucrose-specific PTS, IIBC component (EC 2.7.1.69)
 
Bacillus amyloliquefaciens FZB42

Gene: RBAM_035290: Sucrose-specific PTS, IIBC component (EC 2.7.1.69)
*
Bacillus cereus ATCC 14579

Site:
position = -49
score = 6.70728
sequence = TTGCGGAACCGGTTCCATAA

Gene: BC0775: Sucrose-specific PTS, IIBC component (EC 2.7.1.69)
 
Bacillus clausii KSM-K16

Gene: ABC3764: Sucrose-specific PTS, IIBC component (EC 2.7.1.69)
*
Bacillus halodurans C-125

Site:
position = -97
score = 6.06451
sequence = GAATGGAACCGGTTCCTAAA

Site:
position = -48
score = 6.98814
sequence = TTGTGGAACCGGTTCCTAAA

Gene: BH1856: Sucrose-specific PTS, IIBC component (EC 2.7.1.69)
 
Bacillus licheniformis DSM 13

Gene: BLi04017: Sucrose-specific PTS, IIBC component (EC 2.7.1.69)
 
Bacillus pumilus SAFR-032

Gene: BPUM_3452: Sucrose-specific PTS, IIBC component (EC 2.7.1.69)
 2
Bacillus subtilis subsp. subtilis str. 168

Gene: BSU38050: Sucrose-specific PTS, IIBC component (EC 2.7.1.69)

Gene: BSU38410: Sucrose-specific PTS, IIBC component (EC 2.7.1.69)
 
Geobacillus kaustophilus HTA426

Gene: GK3444: Sucrose-specific PTS, IIBC component (EC 2.7.1.69)
 
Oceanobacillus iheyensis HTE831
 
Paenibacillus sp. JDR-2
Sucrose-specific PTS, IIBC component (EC 2.7.1.69)
scrK
 
Anoxybacillus flavithermus WK1

Gene: Aflv_2784: Fructokinase (EC 2.7.1.4)
 
Bacillus amyloliquefaciens FZB42

Gene: RBAM_006560: Fructokinase (EC 2.7.1.4)
 
Bacillus cereus ATCC 14579

Gene: BC0773: Fructokinase (EC 2.7.1.4)
 
Bacillus clausii KSM-K16
 
Bacillus halodurans C-125

Gene: BH1857: Fructokinase (EC 2.7.1.4)
 
Bacillus licheniformis DSM 13
 
Bacillus pumilus SAFR-032
 
Bacillus subtilis subsp. subtilis str. 168

Gene: BSU06170: Fructokinase (EC 2.7.1.4)
 
Geobacillus kaustophilus HTA426
 
Oceanobacillus iheyensis HTE831
 
Paenibacillus sp. JDR-2

Gene: Pjdr2_5211: Fructokinase (EC 2.7.1.4)
Fructokinase (EC 2.7.1.4)
scrB
 
Anoxybacillus flavithermus WK1

Gene: Aflv_2783: Sucrose-6-phosphate hydrolase (EC 3.2.1.26)
 
Bacillus amyloliquefaciens FZB42

Gene: RBAM_035280: Sucrose-6-phosphate hydrolase (EC 3.2.1.26)
 
Bacillus cereus ATCC 14579

Gene: BC0774: Sucrose-6-phosphate hydrolase (EC 3.2.1.26)
*
Bacillus clausii KSM-K16

Site:
position = -116
score = 6.22305
sequence = TTATGGAACCGGTTCCGAAG

Site:
position = -54
score = 6.79154
sequence = TATTGGAACCGGTTCCTAAA

Gene: ABC3765: Sucrose-6-phosphate hydrolase (EC 3.2.1.26)
 
Bacillus halodurans C-125

Gene: BH1858: Sucrose-6-phosphate hydrolase (EC 3.2.1.26)
 
Bacillus licheniformis DSM 13

Gene: BLi04016: Sucrose-6-phosphate hydrolase (EC 3.2.1.26)
 
Bacillus pumilus SAFR-032

Gene: BPUM_3451: Sucrose-6-phosphate hydrolase (EC 3.2.1.26)
 
Bacillus subtilis subsp. subtilis str. 168

Gene: BSU38040: Sucrose-6-phosphate hydrolase (EC 3.2.1.26)
 
Geobacillus kaustophilus HTA426

Gene: GK3443: Sucrose-6-phosphate hydrolase (EC 3.2.1.26)
 
Oceanobacillus iheyensis HTE831
 
Paenibacillus sp. JDR-2
Sucrose-6-phosphate hydrolase (EC 3.2.1.26)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD