Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog BH1250 - Bacillales

Properties
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Sugar utilization
Effector:
Phylum: Firmicutes
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 9 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Anoxybacillus flavithermus WK1 5 1
Bacillus amyloliquefaciens FZB42
Bacillus cereus ATCC 14579 2 2
Bacillus clausii KSM-K16 6 2
Bacillus halodurans C-125 8 2
Bacillus licheniformis DSM 13
Bacillus pumilus SAFR-032
Bacillus subtilis subsp. subtilis str. 168
Geobacillus kaustophilus HTA426
Oceanobacillus iheyensis HTE831
Paenibacillus sp. JDR-2
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
BH1244
 
Anoxybacillus flavithermus WK1

Gene: Aflv_2274: Predicted sugar ABC transporter, substrate-binding protein
 
Bacillus amyloliquefaciens FZB42
 
Bacillus cereus ATCC 14579
 
Bacillus clausii KSM-K16
*
Bacillus halodurans C-125

Site:
position = -102
score = 5.6098
sequence = ATATGAGAACGATTCCATAG

Site:
position = -32
score = 5.28819
sequence = ATGTGAAATCGATTCCATAT

Gene: BH1244: Predicted sugar ABC transporter, substrate-binding protein
 
Bacillus licheniformis DSM 13
 
Bacillus pumilus SAFR-032
 
Bacillus subtilis subsp. subtilis str. 168
 
Geobacillus kaustophilus HTA426

Gene: GK2123: Predicted sugar ABC transporter, substrate-binding protein
 
Oceanobacillus iheyensis HTE831

Gene: OB3474: Predicted sugar ABC transporter, substrate-binding protein
 
Paenibacillus sp. JDR-2
Predicted sugar ABC transporter, substrate-binding protein
BH1245
 
Anoxybacillus flavithermus WK1

Gene: Aflv_2273: Predicted sugar ABC transporter, permease protein 1
 
Bacillus amyloliquefaciens FZB42
 
Bacillus cereus ATCC 14579
 
Bacillus clausii KSM-K16
 
Bacillus halodurans C-125

Gene: BH1245: Predicted sugar ABC transporter, permease protein 1
 
Bacillus licheniformis DSM 13
 
Bacillus pumilus SAFR-032
 
Bacillus subtilis subsp. subtilis str. 168
 
Geobacillus kaustophilus HTA426

Gene: GK2122: Predicted sugar ABC transporter, permease protein 1
 
Oceanobacillus iheyensis HTE831

Gene: OB3473: Predicted sugar ABC transporter, permease protein 1
 
Paenibacillus sp. JDR-2
Predicted sugar ABC transporter, permease protein 1
BH1246
 
Anoxybacillus flavithermus WK1

Gene: Aflv_2272: Predicted sugar ABC transporter, permease protein 2
 
Bacillus amyloliquefaciens FZB42
 
Bacillus cereus ATCC 14579
 
Bacillus clausii KSM-K16
 
Bacillus halodurans C-125

Gene: BH1246: Predicted sugar ABC transporter, permease protein 2
 
Bacillus licheniformis DSM 13
 
Bacillus pumilus SAFR-032
 
Bacillus subtilis subsp. subtilis str. 168
 
Geobacillus kaustophilus HTA426

Gene: GK2121: Predicted sugar ABC transporter, permease protein 2
 
Oceanobacillus iheyensis HTE831

Gene: OB3472: Predicted sugar ABC transporter, permease protein 2
 
Paenibacillus sp. JDR-2
Predicted sugar ABC transporter, permease protein 2
BH1247
 
Anoxybacillus flavithermus WK1
 
Bacillus amyloliquefaciens FZB42
 
Bacillus cereus ATCC 14579
 
Bacillus clausii KSM-K16

Gene: ABC1573: Conserved hypothetical protein
 
Bacillus halodurans C-125

Gene: BH1247: Conserved hypothetical protein
 
Bacillus licheniformis DSM 13
 
Bacillus pumilus SAFR-032
 
Bacillus subtilis subsp. subtilis str. 168
 
Geobacillus kaustophilus HTA426

Gene: GK2113: Conserved hypothetical protein
 
Oceanobacillus iheyensis HTE831

Gene: OB2566: Conserved hypothetical protein
 
Paenibacillus sp. JDR-2

Gene: Pjdr2_5588: Conserved hypothetical protein
Conserved hypothetical protein
BH1248
 
Anoxybacillus flavithermus WK1
 
Bacillus amyloliquefaciens FZB42
 
Bacillus cereus ATCC 14579
 
Bacillus clausii KSM-K16

Gene: ABC0796: Myo-inositol 2-dehydrogenase 1 (EC 1.1.1.18)
 
Bacillus halodurans C-125

Gene: BH1248: Myo-inositol 2-dehydrogenase 1 (EC 1.1.1.18)
 
Bacillus licheniformis DSM 13
 
Bacillus pumilus SAFR-032
 
Bacillus subtilis subsp. subtilis str. 168
 
Geobacillus kaustophilus HTA426
 
Oceanobacillus iheyensis HTE831

Gene: OB2565: Myo-inositol 2-dehydrogenase 1 (EC 1.1.1.18)
 
Paenibacillus sp. JDR-2

Gene: Pjdr2_4891: Myo-inositol 2-dehydrogenase 1 (EC 1.1.1.18)
Myo-inositol 2-dehydrogenase 1 (EC 1.1.1.18)
BH1249
 
Anoxybacillus flavithermus WK1
 
Bacillus amyloliquefaciens FZB42
 
Bacillus cereus ATCC 14579
*
Bacillus clausii KSM-K16

Site:
position = -31
score = 4.92242
sequence = ATATGAGATCGATCTCAGAG

Gene: ABC0795: Inosose isomerase (EC 5.3.99.-)
 
Bacillus halodurans C-125

Gene: BH1249: Inosose isomerase (EC 5.3.99.-)
 
Bacillus licheniformis DSM 13
 
Bacillus pumilus SAFR-032
 
Bacillus subtilis subsp. subtilis str. 168
 
Geobacillus kaustophilus HTA426

Gene: GK2111: Inosose isomerase (EC 5.3.99.-)
 
Oceanobacillus iheyensis HTE831

Gene: OB2563: Inosose isomerase (EC 5.3.99.-)
 
Paenibacillus sp. JDR-2

Gene: Pjdr2_5725: Inosose isomerase (EC 5.3.99.-)
Inosose isomerase (EC 5.3.99.-)
BH1250
*
Anoxybacillus flavithermus WK1

Site:
position = -56
score = 6.26112
sequence = ATATGAAAACGATTTCATTC

Gene: Aflv_2275: Predicted sugar utilization transcriptional regulator, LacI family
 
Bacillus amyloliquefaciens FZB42
*
Bacillus cereus ATCC 14579

Site:
position = -96
score = 5.89714
sequence = TTAAGAAAACGTTTTCATGC

Gene: BC1083: Predicted sugar utilization transcriptional regulator, LacI family
*
Bacillus clausii KSM-K16

Site:
position = -33
score = 5.86697
sequence = AAATGAGAACGTTTTCAATA

Gene: ABC1572: Predicted sugar utilization transcriptional regulator, LacI family
 
Bacillus halodurans C-125

Gene: BH1250: Predicted sugar utilization transcriptional regulator, LacI family
 
Bacillus licheniformis DSM 13
 
Bacillus pumilus SAFR-032
 
Bacillus subtilis subsp. subtilis str. 168
 
Geobacillus kaustophilus HTA426
 
Oceanobacillus iheyensis HTE831
 
Paenibacillus sp. JDR-2
Predicted sugar utilization transcriptional regulator, LacI family
BH2903
 
Anoxybacillus flavithermus WK1

Gene: Aflv_2271: Oligo-1,6-glucosidase (EC 3.2.1.10)
 
Bacillus amyloliquefaciens FZB42
*
Bacillus cereus ATCC 14579

Site:
position = -183
score = 6.05731
sequence = AAAATAAAACGTTTTCATAT

Site:
position = -241
score = 5.43801
sequence = TTATGCAAACGTTTTCTTTG

Gene: BC4015: Oligo-1,6-glucosidase (EC 3.2.1.10)
 
Bacillus clausii KSM-K16
*
Bacillus halodurans C-125

Site:
position = -32
score = 4.6702
sequence = TTACGTAAACGTTTTCGTTA

Gene: BH2903: Oligo-1,6-glucosidase (EC 3.2.1.10)
 
Bacillus licheniformis DSM 13
 
Bacillus pumilus SAFR-032
 
Bacillus subtilis subsp. subtilis str. 168
 
Geobacillus kaustophilus HTA426
 
Oceanobacillus iheyensis HTE831
 
Paenibacillus sp. JDR-2
Oligo-1,6-glucosidase (EC 3.2.1.10)
ABC1574
 
Anoxybacillus flavithermus WK1
 
Bacillus amyloliquefaciens FZB42
 
Bacillus cereus ATCC 14579
 
Bacillus clausii KSM-K16

Gene: ABC1574: Myo-inositol 2-dehydrogenase 1 (EC 1.1.1.18)
 
Bacillus halodurans C-125
 
Bacillus licheniformis DSM 13
 
Bacillus pumilus SAFR-032
 
Bacillus subtilis subsp. subtilis str. 168
 
Geobacillus kaustophilus HTA426
 
Oceanobacillus iheyensis HTE831

Gene: OB2564: Myo-inositol 2-dehydrogenase 1 (EC 1.1.1.18)
 
Paenibacillus sp. JDR-2
Myo-inositol 2-dehydrogenase 1 (EC 1.1.1.18)
ABC0797
 
Anoxybacillus flavithermus WK1
 
Bacillus amyloliquefaciens FZB42
 
Bacillus cereus ATCC 14579
 
Bacillus clausii KSM-K16

Gene: ABC0797: Inosose dehydratase (EC 4.2.1.44)
 
Bacillus halodurans C-125
 
Bacillus licheniformis DSM 13
 
Bacillus pumilus SAFR-032
 
Bacillus subtilis subsp. subtilis str. 168
 
Geobacillus kaustophilus HTA426
 
Oceanobacillus iheyensis HTE831
 
Paenibacillus sp. JDR-2
Inosose dehydratase (EC 4.2.1.44)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD