Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog Bphy_2245 - Burkholderia

Properties
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Sugar utilization
Effector:
Phylum: Proteobacteria/beta
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 2 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Burkholderia cepacia AMMD
Burkholderia glumae BGR1
Burkholderia mallei ATCC 23344
Burkholderia phymatum STM815 6 1
Burkholderia pseudomallei K96243
Burkholderia sp. 383
Burkholderia vietnamiensis G4
Burkholderia xenovorans LB400 6 1
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
Bphy_2245
 
Burkholderia cepacia AMMD
 
Burkholderia glumae BGR1
 
Burkholderia mallei ATCC 23344
*
Burkholderia phymatum STM815

Site:
position = -107
score = 7.42686
sequence = GAATGTAATCGATTACATTT

Gene: Bphy_2245: Predicted sugar utilization transcriptional regulator, LacI family
 
Burkholderia pseudomallei K96243
 
Burkholderia sp. 383
 
Burkholderia vietnamiensis G4
*
Burkholderia xenovorans LB400

Site:
position = -143
score = 7.60951
sequence = AAATGTAATCGATTACATTT

Gene: Bxe_A3676: Predicted sugar utilization transcriptional regulator, LacI family
Predicted sugar utilization transcriptional regulator, LacI family
Bphy_2244
 
Burkholderia cepacia AMMD
 
Burkholderia glumae BGR1
 
Burkholderia mallei ATCC 23344
 
Burkholderia phymatum STM815

Gene: Bphy_2244: Monosaccharide ABC transporter, permease protein
 
Burkholderia pseudomallei K96243
 
Burkholderia sp. 383
 
Burkholderia vietnamiensis G4
 
Burkholderia xenovorans LB400

Gene: Bxe_A3675: Monosaccharide ABC transporter, permease protein
Monosaccharide ABC transporter, permease protein
Bphy_2243
 
Burkholderia cepacia AMMD
 
Burkholderia glumae BGR1
 
Burkholderia mallei ATCC 23344
 
Burkholderia phymatum STM815

Gene: Bphy_2243: Monosaccharide ABC transporter, ATP-binding protein
 
Burkholderia pseudomallei K96243
 
Burkholderia sp. 383
 
Burkholderia vietnamiensis G4
 
Burkholderia xenovorans LB400

Gene: Bxe_A3674: Monosaccharide ABC transporter, ATP-binding protein
Monosaccharide ABC transporter, ATP-binding protein
Bphy_2242
 
Burkholderia cepacia AMMD
 
Burkholderia glumae BGR1
 
Burkholderia mallei ATCC 23344
 
Burkholderia phymatum STM815

Gene: Bphy_2242: Monosaccharide ABC transporter, substrate-binding protein
 
Burkholderia pseudomallei K96243
 
Burkholderia sp. 383
 
Burkholderia vietnamiensis G4
 
Burkholderia xenovorans LB400

Gene: Bxe_A3673: Monosaccharide ABC transporter, substrate-binding protein
Monosaccharide ABC transporter, substrate-binding protein
Bphy_2241
 
Burkholderia cepacia AMMD
 
Burkholderia glumae BGR1
 
Burkholderia mallei ATCC 23344
 
Burkholderia phymatum STM815

Gene: Bphy_2241: Predicted sugar isomerase
 
Burkholderia pseudomallei K96243
 
Burkholderia sp. 383
 
Burkholderia vietnamiensis G4
 
Burkholderia xenovorans LB400

Gene: Bxe_A3672: Predicted sugar isomerase
Predicted sugar isomerase
Bphy_2240
 
Burkholderia cepacia AMMD
 
Burkholderia glumae BGR1
 
Burkholderia mallei ATCC 23344
 
Burkholderia phymatum STM815

Gene: Bphy_2240: Predicted sugar oxidoreductase
 
Burkholderia pseudomallei K96243
 
Burkholderia sp. 383
 
Burkholderia vietnamiensis G4
 
Burkholderia xenovorans LB400

Gene: Bxe_A3671: Predicted sugar oxidoreductase
Predicted sugar oxidoreductase
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD