Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog SCO1956 - Streptomycetaceae

Properties
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Sugar utilization
Effector:
Phylum: Actinobacteria
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 2 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Streptomyces scabiei 87.22
Streptomyces griseus subsp. griseus NBRC 13350
Streptomyces coelicolor A3(2) 2 1
Streptomyces avermitilis MA-4680 2 1
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
SCO1956
 
Streptomyces scabiei 87.22
 
Streptomyces griseus subsp. griseus NBRC 13350
*
Streptomyces coelicolor A3(2)

Site:
position = -85
score = 7.74597
sequence = AAACGCTTGCGCAAGCGTTT

Gene: SCO1956: Transcriptional regulator, LacI family
*
Streptomyces avermitilis MA-4680

Site:
position = -100
score = 7.74597
sequence = AAACGCTTGCGCAAGCGTTT

Gene: SAV_6288: Transcriptional regulator, LacI family
Transcriptional regulator, LacI family
scrK
 
Streptomyces scabiei 87.22

Gene: SCAB_69581: Fructokinase (EC 2.7.1.4)
 
Streptomyces griseus subsp. griseus NBRC 13350
 
Streptomyces coelicolor A3(2)

Gene: SCO1957: Fructokinase (EC 2.7.1.4)
 
Streptomyces avermitilis MA-4680

Gene: SAV_6287: Fructokinase (EC 2.7.1.4)
Fructokinase (EC 2.7.1.4)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD