Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog Bphy_6994 - Burkholderia

Properties
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: NULL
Effector:
Phylum: Proteobacteria/beta
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 2 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Burkholderia cepacia AMMD
Burkholderia glumae BGR1
Burkholderia mallei ATCC 23344
Burkholderia phymatum STM815 5 1
Burkholderia pseudomallei K96243
Burkholderia sp. 383 5 1
Burkholderia vietnamiensis G4
Burkholderia xenovorans LB400
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
Bphy_6992
 
Burkholderia cepacia AMMD
 
Burkholderia glumae BGR1
 
Burkholderia mallei ATCC 23344
*
Burkholderia phymatum STM815

Site:
position = -101
score = 6.60711
sequence = TTACTGTATCGATACACTAA

Gene: Bphy_6992: Putative TRAP transporter, periplasmic protein
 
Burkholderia pseudomallei K96243
*
Burkholderia sp. 383

Site:
position = -65
score = 6.60711
sequence = TTACTGTATCGATACACTAA

Gene: Bcep18194_B1309: Putative TRAP transporter, periplasmic protein
 
Burkholderia vietnamiensis G4
 
Burkholderia xenovorans LB400
Putative TRAP transporter, periplasmic protein
Bphy_6993
 
Burkholderia cepacia AMMD
 
Burkholderia glumae BGR1
 
Burkholderia mallei ATCC 23344
 
Burkholderia phymatum STM815

Gene: Bphy_6993: Putative TRAP transporter, permease protein
 
Burkholderia pseudomallei K96243
 
Burkholderia sp. 383

Gene: Bcep18194_B1310: Putative TRAP transporter, permease protein
 
Burkholderia vietnamiensis G4
 
Burkholderia xenovorans LB400
Putative TRAP transporter, permease protein
Bphy_6994
 
Burkholderia cepacia AMMD
 
Burkholderia glumae BGR1
 
Burkholderia mallei ATCC 23344
 
Burkholderia phymatum STM815

Gene: Bphy_6994: Predicted transcriptional regulator, LacI family
 
Burkholderia pseudomallei K96243
 
Burkholderia sp. 383

Gene: Bcep18194_B1311: Predicted transcriptional regulator, LacI family
 
Burkholderia vietnamiensis G4
 
Burkholderia xenovorans LB400
Predicted transcriptional regulator, LacI family
PF00389
 
Burkholderia cepacia AMMD
 
Burkholderia glumae BGR1
 
Burkholderia mallei ATCC 23344
 
Burkholderia phymatum STM815

Gene: Bphy_6995: Putative phosphoglycerate dehydrogenase
 
Burkholderia pseudomallei K96243
 
Burkholderia sp. 383

Gene: Bcep18194_B1312: Putative phosphoglycerate dehydrogenase
 
Burkholderia vietnamiensis G4
 
Burkholderia xenovorans LB400
Putative phosphoglycerate dehydrogenase
PF04909
 
Burkholderia cepacia AMMD
 
Burkholderia glumae BGR1
 
Burkholderia mallei ATCC 23344
 
Burkholderia phymatum STM815

Gene: Bphy_6996: Amidohydrolase 2
 
Burkholderia pseudomallei K96243
 
Burkholderia sp. 383

Gene: Bcep18194_B1313: Amidohydrolase 2
 
Burkholderia vietnamiensis G4
 
Burkholderia xenovorans LB400
Amidohydrolase 2
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD