Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog RbsR - Streptomycetaceae

Properties
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Ribose utilization
Effector: Ribose
Phylum: Actinobacteria
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 3 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Streptomyces avermitilis MA-4680 5 1
Streptomyces coelicolor A3(2) 5 1
Streptomyces griseus subsp. griseus NBRC 13350 5 1
Streptomyces scabiei 87.22
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
rbsR
*
Streptomyces avermitilis MA-4680

Site:
position = -66
score = 6.45418
sequence = CGATGTAATCGATTCCACGA

Gene: SAV_5320: Transcriptional repressor of ribose utilization, LacI famil
*
Streptomyces coelicolor A3(2)

Site:
position = -35
score = 6.82754
sequence = CCGTGTAATCGATTCCACGA

Gene: SCO2745: Transcriptional repressor of ribose utilization, LacI famil
*
Streptomyces griseus subsp. griseus NBRC 13350

Site:
position = -96
score = 6.82754
sequence = CCGTGTAATCGATTCCATGG

Gene: SGR_1097: Transcriptional repressor of ribose utilization, LacI famil
 
Streptomyces scabiei 87.22
Transcriptional repressor of ribose utilization, LacI famil
rbsA
 
Streptomyces avermitilis MA-4680

Gene: SAV_5319: Ribose ABC transporter, ATP-binding protein (TC 3.A.1.2.1)
 
Streptomyces coelicolor A3(2)

Gene: SCO2746: Ribose ABC transporter, ATP-binding protein (TC 3.A.1.2.1)
 
Streptomyces griseus subsp. griseus NBRC 13350

Gene: SGR_1096: Ribose ABC transporter, ATP-binding protein (TC 3.A.1.2.1)
 
Streptomyces scabiei 87.22
Ribose ABC transporter, ATP-binding protein (TC 3.A.1.2.1)
rbsBC
 
Streptomyces avermitilis MA-4680

Gene: SAV_5318: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1) / Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1)
 
Streptomyces coelicolor A3(2)

Gene: SCO2747: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1) / Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1)
 
Streptomyces griseus subsp. griseus NBRC 13350

Gene: SGR_1095: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1) / Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1)
 
Streptomyces scabiei 87.22
Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1) / Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1)
rbsK
 
Streptomyces avermitilis MA-4680

Gene: SAV_5317: Ribokinase (EC 2.7.1.15)
 
Streptomyces coelicolor A3(2)

Gene: SCO2748: Ribokinase (EC 2.7.1.15)
 
Streptomyces griseus subsp. griseus NBRC 13350

Gene: SGR_1094: Ribokinase (EC 2.7.1.15)
 
Streptomyces scabiei 87.22
Ribokinase (EC 2.7.1.15)
rbsD
 
Streptomyces avermitilis MA-4680

Gene: SAV_5316: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)
 
Streptomyces coelicolor A3(2)

Gene: SCO2749: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)
 
Streptomyces griseus subsp. griseus NBRC 13350

Gene: SGR_1093: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)
 
Streptomyces scabiei 87.22
D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD