Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog SCO5692 - Streptomycetaceae

Properties
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Sugar utilization
Effector:
Phylum: Actinobacteria
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 13 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Streptomyces avermitilis MA-4680 9 3
Streptomyces coelicolor A3(2) 8 3
Streptomyces griseus subsp. griseus NBRC 13350
Streptomyces scabiei 87.22 8 3
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
SAV_2577
*
Streptomyces avermitilis MA-4680

Site:
position = -151
score = 6.60343
sequence = ACATCGAAGCGCTTCGACTC

Gene: SAV_2577: Predicted multiple sugar ABC transporter, substrate-binding protein
*
Streptomyces coelicolor A3(2)

Site:
position = -218
score = 6.3476
sequence = ACGTCGAAGCGCTTCGATGC

Site:
position = -109
score = 6.68391
sequence = ACATCGAAGCGCTTCGACAC

Gene: SCO5686: Predicted multiple sugar ABC transporter, substrate-binding protein
 
Streptomyces griseus subsp. griseus NBRC 13350
*
Streptomyces scabiei 87.22

Site:
position = -151
score = 6.71373
sequence = ACATCGAAGCGCTTCGACTG

Gene: SCAB_25621: Predicted multiple sugar ABC transporter, substrate-binding protein
Predicted multiple sugar ABC transporter, substrate-binding protein
SAV_2576
 
Streptomyces avermitilis MA-4680

Gene: SAV_2576: Predicted multiple sugar ABC transporter, permease protein 1
 
Streptomyces coelicolor A3(2)

Gene: SCO5687: Predicted multiple sugar ABC transporter, permease protein 1
 
Streptomyces griseus subsp. griseus NBRC 13350
 
Streptomyces scabiei 87.22

Gene: SCAB_25611: Predicted multiple sugar ABC transporter, permease protein 1
Predicted multiple sugar ABC transporter, permease protein 1
SAV_2575
 
Streptomyces avermitilis MA-4680

Gene: SAV_2575: Predicted multiple sugar ABC transporter, permease protein 2
 
Streptomyces coelicolor A3(2)

Gene: SCO5688: Predicted multiple sugar ABC transporter, permease protein 2
 
Streptomyces griseus subsp. griseus NBRC 13350
 
Streptomyces scabiei 87.22

Gene: SCAB_25601: Predicted multiple sugar ABC transporter, permease protein 2
Predicted multiple sugar ABC transporter, permease protein 2
SAV_2574
 
Streptomyces avermitilis MA-4680

Gene: SAV_2574: Predicted glycosyl hydrolase
 
Streptomyces coelicolor A3(2)
 
Streptomyces griseus subsp. griseus NBRC 13350
 
Streptomyces scabiei 87.22

Gene: SCAB_25591: Predicted glycosyl hydrolase
Predicted glycosyl hydrolase
SAV_2573
 
Streptomyces avermitilis MA-4680

Gene: SAV_2573: Beta-galactosidase (EC 3.2.1.23)
 
Streptomyces coelicolor A3(2)

Gene: SCO5689: Beta-galactosidase (EC 3.2.1.23)
 
Streptomyces griseus subsp. griseus NBRC 13350
 
Streptomyces scabiei 87.22

Gene: SCAB_25581: Beta-galactosidase (EC 3.2.1.23)
Beta-galactosidase (EC 3.2.1.23)
SAV_2572
 
Streptomyces avermitilis MA-4680

Gene: SAV_2572: Predicted secreted protein
 
Streptomyces coelicolor A3(2)

Gene: SCO5690: Predicted secreted protein
 
Streptomyces griseus subsp. griseus NBRC 13350
 
Streptomyces scabiei 87.22
Predicted secreted protein
SAV_2571
 
Streptomyces avermitilis MA-4680

Gene: SAV_2571: Predicted sugar hydrolase
 
Streptomyces coelicolor A3(2)

Gene: SCO5691: Predicted sugar hydrolase
 
Streptomyces griseus subsp. griseus NBRC 13350
 
Streptomyces scabiei 87.22

Gene: SCAB_25571: Predicted sugar hydrolase
Predicted sugar hydrolase
 
CRON 2.
SCO5692
*
Streptomyces avermitilis MA-4680

Site:
position = -125
score = 6.59019
sequence = TTGTCGAAGCGCTTCGACAG

Gene: SAV_2569: Predicted sugar utilization transcriptional regulator, LacI family
*
Streptomyces coelicolor A3(2)

Site:
position = -124
score = 6.86448
sequence = GAGTCGAAGCGCTTCGACGG

Gene: SCO5692: Predicted sugar utilization transcriptional regulator, LacI family
 
Streptomyces griseus subsp. griseus NBRC 13350
*
Streptomyces scabiei 87.22

Site:
position = -125
score = 6.3048
sequence = TGATCGAAGCGCTTCGACAA

Gene: SCAB_25511: Predicted sugar utilization transcriptional regulator, LacI family
Predicted sugar utilization transcriptional regulator, LacI family
 
CRON 3.
bglX
*
Streptomyces avermitilis MA-4680

Site:
position = -53
score = 6.54262
sequence = GCATCGAAGCGCTTCGAAAG

Site:
position = -235
score = 6.33266
sequence = GAGTCGAAGCGCTTCGATGT

Gene: SAV_2578: Glycoside hydrolase
*
Streptomyces coelicolor A3(2)

Site:
position = -51
score = 6.73456
sequence = GCATCGAAGCGCTTCGACGT

Site:
position = -160
score = 6.22831
sequence = GTGTCGAAGCGCTTCGATGT

Gene: SCO5685: Glycoside hydrolase
 
Streptomyces griseus subsp. griseus NBRC 13350
*
Streptomyces scabiei 87.22

Site:
position = -53
score = 6.54262
sequence = GCATCGAAGCGCTTCGAAAG

Site:
position = -248
score = 6.16273
sequence = CAGTCGAAGCGCTTCGATGT

Gene: SCAB_25641: Glycoside hydrolase
Glycoside hydrolase
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD