Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog Bamb_2736 - Burkholderia

Properties
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Sugar utilization
Effector:
Phylum: Proteobacteria/beta
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 4 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Burkholderia phymatum STM815
Burkholderia cepacia AMMD 5 2
Burkholderia glumae BGR1
Burkholderia mallei ATCC 23344
Burkholderia pseudomallei K96243
Burkholderia sp. 383 4 2
Burkholderia vietnamiensis G4
Burkholderia xenovorans LB400
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
SSF51658
 
Burkholderia phymatum STM815
*
Burkholderia cepacia AMMD

Site:
position = -92
score = 6.28597
sequence = ATTGGCGATTTTTCGTCAAC

Gene: Bamb_2737: Xylose isomerase-like, TIM barrel domain
 
Burkholderia glumae BGR1
 
Burkholderia mallei ATCC 23344
 
Burkholderia pseudomallei K96243
*
Burkholderia sp. 383

Site:
position = -27
score = 6.28597
sequence = ATTGGCGATTTTTCGTCAAC

Gene: Bcep18194_A6012: Xylose isomerase-like, TIM barrel domain
 
Burkholderia vietnamiensis G4
 
Burkholderia xenovorans LB400
Xylose isomerase-like, TIM barrel domain
COG4130
 
Burkholderia phymatum STM815
 
Burkholderia cepacia AMMD

Gene: Bamb_2738: Putative inosose isomerase
 
Burkholderia glumae BGR1
 
Burkholderia mallei ATCC 23344
 
Burkholderia pseudomallei K96243
 
Burkholderia sp. 383

Gene: Bcep18194_A6013: Putative inosose isomerase
 
Burkholderia vietnamiensis G4
 
Burkholderia xenovorans LB400
Putative inosose isomerase
Bamb_2739
 
Burkholderia phymatum STM815
 
Burkholderia cepacia AMMD

Gene: Bamb_2739: Hypothetical protein
 
Burkholderia glumae BGR1
 
Burkholderia mallei ATCC 23344
 
Burkholderia pseudomallei K96243
 
Burkholderia sp. 383
 
Burkholderia vietnamiensis G4
 
Burkholderia xenovorans LB400
Hypothetical protein
iolG
 
Burkholderia phymatum STM815

Gene: Bphy_1595: Predicted myo-inositol 2-dehydrogenase
 
Burkholderia cepacia AMMD

Gene: Bamb_2740: Predicted myo-inositol 2-dehydrogenase
 
Burkholderia glumae BGR1

Gene: bglu_1g21990: Predicted myo-inositol 2-dehydrogenase
 
Burkholderia mallei ATCC 23344

Gene: BMA0918: Predicted myo-inositol 2-dehydrogenase
 
Burkholderia pseudomallei K96243

Gene: BPSL1989: Predicted myo-inositol 2-dehydrogenase
 
Burkholderia sp. 383

Gene: Bcep18194_A6014: Predicted myo-inositol 2-dehydrogenase
 
Burkholderia vietnamiensis G4
 
Burkholderia xenovorans LB400

Gene: Bxe_A1331: Predicted myo-inositol 2-dehydrogenase
Predicted myo-inositol 2-dehydrogenase
 
CRON 2.
Bamb_2736
 
Burkholderia phymatum STM815
*
Burkholderia cepacia AMMD

Site:
position = -51
score = 6.63952
sequence = GTTGACGAAATTTCGCCATC

Gene: Bamb_2736: Predicted sugar utilization transcriptional regulator, LacI family
 
Burkholderia glumae BGR1
 
Burkholderia mallei ATCC 23344
 
Burkholderia pseudomallei K96243
*
Burkholderia sp. 383

Site:
position = -77
score = 6.63952
sequence = GTTGACGAAATTTCGCCATC

Gene: Bcep18194_A6011: Predicted sugar utilization transcriptional regulator, LacI family
 
Burkholderia vietnamiensis G4
 
Burkholderia xenovorans LB400
Predicted sugar utilization transcriptional regulator, LacI family
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD