Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog GntR2 - Bacillales

Properties
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Gluconate utilization
Effector: D-gluconate
Phylum: Firmicutes
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 8 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Anoxybacillus flavithermus WK1
Bacillus amyloliquefaciens FZB42 7 1
Bacillus cereus ATCC 14579
Bacillus clausii KSM-K16 8 1
Bacillus halodurans C-125
Bacillus licheniformis DSM 13
Bacillus pumilus SAFR-032
Bacillus subtilis subsp. subtilis str. 168
Geobacillus kaustophilus HTA426 4 3
Oceanobacillus iheyensis HTE831 9 1
Paenibacillus sp. JDR-2
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
gnd
 
Anoxybacillus flavithermus WK1

Gene: Aflv_0976: 6-phosphogluconate dehydrogenase, decarboxylating (EC 1.1.1.44)
 
Bacillus amyloliquefaciens FZB42

Gene: RBAM_022170: 6-phosphogluconate dehydrogenase, decarboxylating (EC 1.1.1.44)
 
Bacillus cereus ATCC 14579
 
Bacillus clausii KSM-K16

Gene: ABC1926: 6-phosphogluconate dehydrogenase, decarboxylating (EC 1.1.1.44)
 
Bacillus halodurans C-125
 
Bacillus licheniformis DSM 13

Gene: BLi02567: 6-phosphogluconate dehydrogenase, decarboxylating (EC 1.1.1.44)
 
Bacillus pumilus SAFR-032

Gene: BPUM_2124: 6-phosphogluconate dehydrogenase, decarboxylating (EC 1.1.1.44)
 
Bacillus subtilis subsp. subtilis str. 168

Gene: BSU23860: 6-phosphogluconate dehydrogenase, decarboxylating (EC 1.1.1.44)
*
Geobacillus kaustophilus HTA426

Site:
position = -92
score = 6.55528
sequence = TTCCTAAATCGGTTTAGAAA

Gene: GK2344: 6-phosphogluconate dehydrogenase, decarboxylating (EC 1.1.1.44)
 
Oceanobacillus iheyensis HTE831

Gene: OB0185: 6-phosphogluconate dehydrogenase, decarboxylating (EC 1.1.1.44)
 
Paenibacillus sp. JDR-2

Gene: Pjdr2_3810: 6-phosphogluconate dehydrogenase, decarboxylating (EC 1.1.1.44)
6-phosphogluconate dehydrogenase, decarboxylating (EC 1.1.1.44)
 
CRON 2.
gntR2
 
Anoxybacillus flavithermus WK1
 
Bacillus amyloliquefaciens FZB42

Gene: RBAM_018000: Putative gluconate utilization transcriptional repressor GntR, LacI family
 
Bacillus cereus ATCC 14579
*
Bacillus clausii KSM-K16

Site:
position = -32
score = 6.79103
sequence = CTACTAAATCGGTTTAGTAA

Gene: ABC3358: Putative gluconate utilization transcriptional repressor GntR, LacI family
 
Bacillus halodurans C-125
 
Bacillus licheniformis DSM 13
 
Bacillus pumilus SAFR-032
 
Bacillus subtilis subsp. subtilis str. 168
*
Geobacillus kaustophilus HTA426

Site:
position = -36
score = 6.37203
sequence = GAACTAAATCGATTTAGTCT

Gene: GK1942: Putative gluconate utilization transcriptional repressor GntR, LacI family
*
Oceanobacillus iheyensis HTE831

Site:
position = -54
score = 6.80988
sequence = TTACTAAATCGATTTACTAA

Site:
position = -41
score = 5.57204
sequence = TTACTAAACCGTTTTAGTTA

Gene: OB2705: Putative gluconate utilization transcriptional repressor GntR, LacI family
 
Paenibacillus sp. JDR-2
Putative gluconate utilization transcriptional repressor GntR, LacI family
PF01380
 
Anoxybacillus flavithermus WK1
 
Bacillus amyloliquefaciens FZB42
 
Bacillus cereus ATCC 14579
 
Bacillus clausii KSM-K16

Gene: ABC3354: Putative sugar phosphate isomerase, PF01380 family
 
Bacillus halodurans C-125
 
Bacillus licheniformis DSM 13
 
Bacillus pumilus SAFR-032
 
Bacillus subtilis subsp. subtilis str. 168
 
Geobacillus kaustophilus HTA426
 
Oceanobacillus iheyensis HTE831

Gene: OB2704: Putative sugar phosphate isomerase, PF01380 family
 
Paenibacillus sp. JDR-2
Putative sugar phosphate isomerase, PF01380 family
kdgA
 
Anoxybacillus flavithermus WK1
 
Bacillus amyloliquefaciens FZB42

Gene: RBAM_017970: 2-dehydro-3-deoxyphosphogluconate aldolase (EC 4.1.2.14)
 
Bacillus cereus ATCC 14579
 
Bacillus clausii KSM-K16
 
Bacillus halodurans C-125
 
Bacillus licheniformis DSM 13
 
Bacillus pumilus SAFR-032
 
Bacillus subtilis subsp. subtilis str. 168
 
Geobacillus kaustophilus HTA426
 
Oceanobacillus iheyensis HTE831

Gene: OB2703: 2-dehydro-3-deoxyphosphogluconate aldolase (EC 4.1.2.14)
 
Paenibacillus sp. JDR-2
2-dehydro-3-deoxyphosphogluconate aldolase (EC 4.1.2.14)
ABC3357
 
Anoxybacillus flavithermus WK1
 
Bacillus amyloliquefaciens FZB42
 
Bacillus cereus ATCC 14579
 
Bacillus clausii KSM-K16

Gene: ABC3357: TRAP-type C4-dicarboxylate transport system, periplasmic component
 
Bacillus halodurans C-125
 
Bacillus licheniformis DSM 13
 
Bacillus pumilus SAFR-032
 
Bacillus subtilis subsp. subtilis str. 168
 
Geobacillus kaustophilus HTA426
 
Oceanobacillus iheyensis HTE831

Gene: OB2702: TRAP-type C4-dicarboxylate transport system, periplasmic component
 
Paenibacillus sp. JDR-2
TRAP-type C4-dicarboxylate transport system, periplasmic component
ABC3356
 
Anoxybacillus flavithermus WK1
 
Bacillus amyloliquefaciens FZB42
 
Bacillus cereus ATCC 14579
 
Bacillus clausii KSM-K16

Gene: ABC3356: TRAP-type C4-dicarboxylate transport system, small permease component
 
Bacillus halodurans C-125
 
Bacillus licheniformis DSM 13
 
Bacillus pumilus SAFR-032
 
Bacillus subtilis subsp. subtilis str. 168
 
Geobacillus kaustophilus HTA426
 
Oceanobacillus iheyensis HTE831

Gene: OB2701: TRAP-type C4-dicarboxylate transport system, small permease component
 
Paenibacillus sp. JDR-2
TRAP-type C4-dicarboxylate transport system, small permease component
ABC3355
 
Anoxybacillus flavithermus WK1
 
Bacillus amyloliquefaciens FZB42
 
Bacillus cereus ATCC 14579
 
Bacillus clausii KSM-K16

Gene: ABC3355: TRAP-type C4-dicarboxylate transport system, large permease component
 
Bacillus halodurans C-125
 
Bacillus licheniformis DSM 13
 
Bacillus pumilus SAFR-032
 
Bacillus subtilis subsp. subtilis str. 168
 
Geobacillus kaustophilus HTA426
 
Oceanobacillus iheyensis HTE831

Gene: OB2700: TRAP-type C4-dicarboxylate transport system, large permease component
 
Paenibacillus sp. JDR-2
TRAP-type C4-dicarboxylate transport system, large permease component
BC2796
 
Anoxybacillus flavithermus WK1
 
Bacillus amyloliquefaciens FZB42
 
Bacillus cereus ATCC 14579
 
Bacillus clausii KSM-K16

Gene: ABC3353: Ribose 5-phosphate isomerase A (EC 5.3.1.6)
 
Bacillus halodurans C-125
 
Bacillus licheniformis DSM 13
 
Bacillus pumilus SAFR-032
 
Bacillus subtilis subsp. subtilis str. 168
 
Geobacillus kaustophilus HTA426
 
Oceanobacillus iheyensis HTE831

Gene: OB2699: Ribose 5-phosphate isomerase A (EC 5.3.1.6)
 
Paenibacillus sp. JDR-2
Ribose 5-phosphate isomerase A (EC 5.3.1.6)
kdgK
 
Anoxybacillus flavithermus WK1
*
Bacillus amyloliquefaciens FZB42

Site:
position = -53
score = 6.00139
sequence = TTACTAAACCGGTTTACCAA

Site:
position = -40
score = 5.68324
sequence = TTACCAAACCGATTTAGTCT

Gene: RBAM_017950: 2-dehydro-3-deoxygluconate kinase (EC 2.7.1.45)
 
Bacillus cereus ATCC 14579
 
Bacillus clausii KSM-K16

Gene: ABC3352: 2-dehydro-3-deoxygluconate kinase (EC 2.7.1.45)
 
Bacillus halodurans C-125
 
Bacillus licheniformis DSM 13
 
Bacillus pumilus SAFR-032
 
Bacillus subtilis subsp. subtilis str. 168
 
Geobacillus kaustophilus HTA426
 
Oceanobacillus iheyensis HTE831

Gene: OB2698: 2-dehydro-3-deoxygluconate kinase (EC 2.7.1.45)
 
Paenibacillus sp. JDR-2
2-dehydro-3-deoxygluconate kinase (EC 2.7.1.45)
PF00215
 
Anoxybacillus flavithermus WK1
 
Bacillus amyloliquefaciens FZB42
 
Bacillus cereus ATCC 14579
 
Bacillus clausii KSM-K16

Gene: ABC3351: Putative sugar-phosphate decarboxylase, PF00215 family
 
Bacillus halodurans C-125
 
Bacillus licheniformis DSM 13
 
Bacillus pumilus SAFR-032
 
Bacillus subtilis subsp. subtilis str. 168
 
Geobacillus kaustophilus HTA426
 
Oceanobacillus iheyensis HTE831

Gene: OB2697: Putative sugar-phosphate decarboxylase, PF00215 family
 
Paenibacillus sp. JDR-2
Putative sugar-phosphate decarboxylase, PF00215 family
yjmD
 
Anoxybacillus flavithermus WK1
 
Bacillus amyloliquefaciens FZB42

Gene: RBAM_017960: Predicted mannuronate reductase (EC 1.1.1.131)
 
Bacillus cereus ATCC 14579
 
Bacillus clausii KSM-K16

Gene: ABC0630: Predicted mannuronate reductase (EC 1.1.1.131)
 
Bacillus halodurans C-125
 
Bacillus licheniformis DSM 13

Gene: BLi01355: Predicted mannuronate reductase (EC 1.1.1.131)
 
Bacillus pumilus SAFR-032
 
Bacillus subtilis subsp. subtilis str. 168

Gene: BSU12330: Predicted mannuronate reductase (EC 1.1.1.131)
 
Geobacillus kaustophilus HTA426
 
Oceanobacillus iheyensis HTE831
 
Paenibacillus sp. JDR-2
Predicted mannuronate reductase (EC 1.1.1.131)
uxuA
 
Anoxybacillus flavithermus WK1
 
Bacillus amyloliquefaciens FZB42

Gene: RBAM_017980: Mannonate dehydratase (EC 4.2.1.8)
 
Bacillus cereus ATCC 14579
 
Bacillus clausii KSM-K16

Gene: ABC0631: Mannonate dehydratase (EC 4.2.1.8)
 
Bacillus halodurans C-125

Gene: BH1063: Mannonate dehydratase (EC 4.2.1.8)
 
Bacillus licheniformis DSM 13

Gene: BLi01356: Mannonate dehydratase (EC 4.2.1.8)
 
Bacillus pumilus SAFR-032
 
Bacillus subtilis subsp. subtilis str. 168

Gene: BSU12340: Mannonate dehydratase (EC 4.2.1.8)
 
Geobacillus kaustophilus HTA426
 
Oceanobacillus iheyensis HTE831
 
Paenibacillus sp. JDR-2

Gene: Pjdr2_0333: Mannonate dehydratase (EC 4.2.1.8)
Mannonate dehydratase (EC 4.2.1.8)
uxuB
 
Anoxybacillus flavithermus WK1
 
Bacillus amyloliquefaciens FZB42

Gene: RBAM_017990: D-mannonate oxidoreductase (EC 1.1.1.57)
 
Bacillus cereus ATCC 14579
 
Bacillus clausii KSM-K16

Gene: ABC0632: D-mannonate oxidoreductase (EC 1.1.1.57)
 
Bacillus halodurans C-125

Gene: BH1067: D-mannonate oxidoreductase (EC 1.1.1.57)
 
Bacillus licheniformis DSM 13

Gene: BLi01357: D-mannonate oxidoreductase (EC 1.1.1.57)
 
Bacillus pumilus SAFR-032
 
Bacillus subtilis subsp. subtilis str. 168

Gene: BSU12350: D-mannonate oxidoreductase (EC 1.1.1.57)
 
Geobacillus kaustophilus HTA426
 
Oceanobacillus iheyensis HTE831
 
Paenibacillus sp. JDR-2

Gene: Pjdr2_0334: D-mannonate oxidoreductase (EC 1.1.1.57)
D-mannonate oxidoreductase (EC 1.1.1.57)
exuT
 
Anoxybacillus flavithermus WK1
 
Bacillus amyloliquefaciens FZB42

Gene: RBAM_018010: Hexuronate transporter
 
Bacillus cereus ATCC 14579
 
Bacillus clausii KSM-K16
 
Bacillus halodurans C-125
 
Bacillus licheniformis DSM 13

Gene: BLi01359: Hexuronate transporter
 
Bacillus pumilus SAFR-032
 
Bacillus subtilis subsp. subtilis str. 168

Gene: BSU12360: Hexuronate transporter
 
Geobacillus kaustophilus HTA426
 
Oceanobacillus iheyensis HTE831
 
Paenibacillus sp. JDR-2
Hexuronate transporter
gntK
 
Anoxybacillus flavithermus WK1
 
Bacillus amyloliquefaciens FZB42

Gene: RBAM_031430: Gluconokinase (EC 2.7.1.12)
 
Bacillus cereus ATCC 14579

Gene: BC2223: Gluconokinase (EC 2.7.1.12)
 
Bacillus clausii KSM-K16
 
Bacillus halodurans C-125
 
Bacillus licheniformis DSM 13
 
Bacillus pumilus SAFR-032

Gene: BPUM_3602: Gluconokinase (EC 2.7.1.12)
 
Bacillus subtilis subsp. subtilis str. 168
 
Geobacillus kaustophilus HTA426

Gene: GK1941: Gluconokinase (EC 2.7.1.12)
 
Oceanobacillus iheyensis HTE831
 
Paenibacillus sp. JDR-2
Gluconokinase (EC 2.7.1.12)
gntP
 
Anoxybacillus flavithermus WK1
 
Bacillus amyloliquefaciens FZB42

Gene: RBAM_031440: GntP family gluconate:proton (H+) symporter
 
Bacillus cereus ATCC 14579

Gene: BC2224: GntP family gluconate:proton (H+) symporter
 
Bacillus clausii KSM-K16
 
Bacillus halodurans C-125
 
Bacillus licheniformis DSM 13
 
Bacillus pumilus SAFR-032

Gene: BPUM_3601: GntP family gluconate:proton (H+) symporter
 
Bacillus subtilis subsp. subtilis str. 168
*
Geobacillus kaustophilus HTA426

Site:
position = -115
score = 6.60778
sequence = TTACTAAATCGATTTAGCCC

Gene: GK1940: GntP family gluconate:proton (H+) symporter
 
Oceanobacillus iheyensis HTE831
 
Paenibacillus sp. JDR-2

Gene: Pjdr2_3594: GntP family gluconate:proton (H+) symporter
GntP family gluconate:proton (H+) symporter
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD