Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog SuxR - Xanthomonadales

Properties
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Sucrose utilization
Effector: Sucrose
Phylum: Proteobacteria/gamma
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 4 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Stenotrophomonas maltophilia K279a
Xanthomonas axonopodis pv. citri str. 306 3 2
Xanthomonas campestris pv. campestris str. ATCC 33913 3 2
Xylella fastidiosa 9a5c
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
omp_suc
 
Stenotrophomonas maltophilia K279a
*
Xanthomonas axonopodis pv. citri str. 306

Site:
position = -190
score = 7.30831
sequence = CGTTGCAATCGATTGTAACG

Gene: XAC3489: Predicted sucrose-specific outer membrane transporter, TonB-dependent
*
Xanthomonas campestris pv. campestris str. ATCC 33913

Site:
position = -190
score = 7.12357
sequence = CTTTGCAATCGATTGTAACG

Gene: XCC3358: Predicted sucrose-specific outer membrane transporter, TonB-dependent
 
Xylella fastidiosa 9a5c
Predicted sucrose-specific outer membrane transporter, TonB-dependent
ams
 
Stenotrophomonas maltophilia K279a
 
Xanthomonas axonopodis pv. citri str. 306

Gene: XAC3490: Amylosucrase
 
Xanthomonas campestris pv. campestris str. ATCC 33913

Gene: XCC3359: Amylosucrase
 
Xylella fastidiosa 9a5c
Amylosucrase
 
CRON 2.
sut1
 
Stenotrophomonas maltophilia K279a
*
Xanthomonas axonopodis pv. citri str. 306

Site:
position = -78
score = 7.30831
sequence = CGTTACAATCGATTGCAACG

Gene: XAC3488: Sucrose transport protein SUT1
*
Xanthomonas campestris pv. campestris str. ATCC 33913

Site:
position = -77
score = 7.12357
sequence = CGTTACAATCGATTGCAAAG

Gene: XCC3357: Sucrose transport protein SUT1
 
Xylella fastidiosa 9a5c
Sucrose transport protein SUT1
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD