Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog SgaR - Psychromonadaceae/Aeromonadales

Properties
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Ascorbate utilization
Effector: Ascorbate-6-phosphate
Phylum: Proteobacteria/gamma
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 12 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Aeromonas hydrophila subsp. hydrophila ATCC 7966 4 2
Aeromonas salmonicida subsp. salmonicida A449 4 2
Moritella sp. PE36
Psychromonas ingrahamii 37 4 2
Psychromonas sp. CNPT3
Tolumonas auensis DSM 9187
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
sgaR
*
Aeromonas hydrophila subsp. hydrophila ATCC 7966

Site:
position = -180
score = 4.79295
sequence = GAAAGTTAGCGCTACCAGAT

Site:
position = -145
score = 6.50021
sequence = CTGTGATAGCGCTATCATTT

Gene: AHA_0174: Ascorbate utilization transcriptional regulator SgaR, LacI family
*
Aeromonas salmonicida subsp. salmonicida A449

Site:
position = -167
score = 4.62619
sequence = ACCAGATAGCGCTAACATGG

Site:
position = -145
score = 6.33806
sequence = TTGTGATAGCGCTATCATTT

Gene: ASA_4215: Ascorbate utilization transcriptional regulator SgaR, LacI family
 
Moritella sp. PE36
*
Psychromonas ingrahamii 37

Site:
position = -200
score = 6.10106
sequence = ATTTGATAGCGCTATCTGAT

Site:
position = -187
score = 6.40142
sequence = ATCTGATAGCGCTATCAAAT

Gene: Ping_2058: Ascorbate utilization transcriptional regulator SgaR, LacI family
 
Psychromonas sp. CNPT3
 
Tolumonas auensis DSM 9187
Ascorbate utilization transcriptional regulator SgaR, LacI family
 
CRON 2.
sgaA
*
Aeromonas hydrophila subsp. hydrophila ATCC 7966

Site:
position = -127
score = 6.50021
sequence = AAATGATAGCGCTATCACAG

Site:
position = -92
score = 4.79295
sequence = ATCTGGTAGCGCTAACTTTC

Gene: AHA_0173: Ascorbate-specific PTS system, EIIA component (EC 2.7.1.-)
*
Aeromonas salmonicida subsp. salmonicida A449

Site:
position = -127
score = 6.33806
sequence = AAATGATAGCGCTATCACAA

Site:
position = -105
score = 4.62619
sequence = CCATGTTAGCGCTATCTGGT

Gene: ASA_4216: Ascorbate-specific PTS system, EIIA component (EC 2.7.1.-)
 
Moritella sp. PE36
*
Psychromonas ingrahamii 37

Site:
position = -118
score = 6.40142
sequence = ATTTGATAGCGCTATCAGAT

Site:
position = -105
score = 6.10106
sequence = ATCAGATAGCGCTATCAAAT

Gene: Ping_2057: Ascorbate-specific PTS system, EIIA component (EC 2.7.1.-)
 
Psychromonas sp. CNPT3
 
Tolumonas auensis DSM 9187
Ascorbate-specific PTS system, EIIA component (EC 2.7.1.-)
sgaB
 
Aeromonas hydrophila subsp. hydrophila ATCC 7966

Gene: AHA_0172: Ascorbate-specific PTS system, EIIB component (EC 2.7.1.69)
 
Aeromonas salmonicida subsp. salmonicida A449

Gene: ASA_4217: Ascorbate-specific PTS system, EIIB component (EC 2.7.1.69)
 
Moritella sp. PE36
 
Psychromonas ingrahamii 37

Gene: Ping_2056: Ascorbate-specific PTS system, EIIB component (EC 2.7.1.69)
 
Psychromonas sp. CNPT3
 
Tolumonas auensis DSM 9187
Ascorbate-specific PTS system, EIIB component (EC 2.7.1.69)
sgaT
 
Aeromonas hydrophila subsp. hydrophila ATCC 7966

Gene: AHA_0171: Ascorbate-specific PTS system, EIIC component
 
Aeromonas salmonicida subsp. salmonicida A449

Gene: ASA_4218: Ascorbate-specific PTS system, EIIC component
 
Moritella sp. PE36
 
Psychromonas ingrahamii 37

Gene: Ping_2055: Ascorbate-specific PTS system, EIIC component
 
Psychromonas sp. CNPT3
 
Tolumonas auensis DSM 9187
Ascorbate-specific PTS system, EIIC component
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD