Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog SCO2753 - Streptomycetaceae

Properties
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Sugar utilization
Effector: New effector
Phylum: Actinobacteria
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 10 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Streptomyces avermitilis MA-4680 4 2
Streptomyces coelicolor A3(2) 5 3
Streptomyces griseus subsp. griseus NBRC 13350 5 3
Streptomyces scabiei 87.22 4 2
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
SCO2753
*
Streptomyces avermitilis MA-4680

Site:
position = -182
score = 6.59482
sequence = CGCAGCAAGCGCTTTCTATG

Gene: SAV_5312: Sugar utilization transctriptional regulator, LacI family
*
Streptomyces coelicolor A3(2)

Site:
position = -163
score = 6.52863
sequence = TACAGCAAGCGCTTTCTATG

Gene: SCO2753: Sugar utilization transctriptional regulator, LacI family
*
Streptomyces griseus subsp. griseus NBRC 13350

Site:
position = -90
score = 6.53179
sequence = CGTAGCAAGCGCTTTCTATC

Gene: SGR_4812: Sugar utilization transctriptional regulator, LacI family
*
Streptomyces scabiei 87.22

Site:
position = -163
score = 6.6257
sequence = CACAGCAAGCGCTTTCTATC

Gene: SCAB_58371: Sugar utilization transctriptional regulator, LacI family
Sugar utilization transctriptional regulator, LacI family
 
CRON 2.
SCO2752
*
Streptomyces avermitilis MA-4680

Site:
position = -72
score = 6.59482
sequence = CATAGAAAGCGCTTGCTGCG

Gene: SAV_5313: Predicted glucose-fructose oxidoreductase
*
Streptomyces coelicolor A3(2)

Site:
position = -87
score = 6.52863
sequence = CATAGAAAGCGCTTGCTGTA

Gene: SCO2752: Predicted glucose-fructose oxidoreductase
*
Streptomyces griseus subsp. griseus NBRC 13350

Site:
position = -39
score = 6.53179
sequence = GATAGAAAGCGCTTGCTACG

Gene: SGR_4813: Predicted glucose-fructose oxidoreductase
*
Streptomyces scabiei 87.22

Site:
position = -98
score = 6.6257
sequence = GATAGAAAGCGCTTGCTGTG

Gene: SCAB_58381: Predicted glucose-fructose oxidoreductase
Predicted glucose-fructose oxidoreductase
SCO2751
 
Streptomyces avermitilis MA-4680

Gene: SAV_5314: Conserved hypothetical protein, potentially related to sugar utilization
 
Streptomyces coelicolor A3(2)

Gene: SCO2751: Conserved hypothetical protein, potentially related to sugar utilization
 
Streptomyces griseus subsp. griseus NBRC 13350

Gene: SGR_4814: Conserved hypothetical protein, potentially related to sugar utilization
 
Streptomyces scabiei 87.22

Gene: SCAB_58391: Conserved hypothetical protein, potentially related to sugar utilization
Conserved hypothetical protein, potentially related to sugar utilization
SCO2750
 
Streptomyces avermitilis MA-4680

Gene: SAV_5315: Predicted sugar phosphate isomerases/epimerase
 
Streptomyces coelicolor A3(2)

Gene: SCO2750: Predicted sugar phosphate isomerases/epimerase
 
Streptomyces griseus subsp. griseus NBRC 13350

Gene: SGR_4815: Predicted sugar phosphate isomerases/epimerase
 
Streptomyces scabiei 87.22

Gene: SCAB_58401: Predicted sugar phosphate isomerases/epimerase
Predicted sugar phosphate isomerases/epimerase
 
CRON 3.
pel
 
Streptomyces avermitilis MA-4680
*
Streptomyces coelicolor A3(2)

Site:
position = -89
score = 4.9414
sequence = CCGAGAAAGCGCTTTCCGCC

Gene: SCO2821: putative secreted pectate lyase
*
Streptomyces griseus subsp. griseus NBRC 13350

Site:
position = -216
score = 6.20379
sequence = TGTAGAAAGCGCTTGCTGTC

Gene: SGR_217: putative secreted pectate lyase
 
Streptomyces scabiei 87.22
putative secreted pectate lyase
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD