Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog BgaR - Streptomycetaceae

Properties
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Galactosides utilization
Effector: Beta-galactosides
Phylum: Actinobacteria
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 8 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Streptomyces scabiei 87.22 2 2
Streptomyces griseus subsp. griseus NBRC 13350
Streptomyces coelicolor A3(2) 6 2
Streptomyces avermitilis MA-4680 6 2
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
bgaR
*
Streptomyces scabiei 87.22

Site:
position = -184
score = 7.17867
sequence = GGATGTTTACGTAAACATCC

Gene: SCAB_43681: Putative transcriptional regulator for beta-galactosides utilization, LacI family
 
Streptomyces griseus subsp. griseus NBRC 13350
*
Streptomyces coelicolor A3(2)

Site:
position = -156
score = 7.09567
sequence = TGATGTTTACGTAAACATGA

Site:
position = -111
score = 6.93314
sequence = TTATGTTTACGTAAACATCT

Gene: SCO7411: Putative transcriptional regulator for beta-galactosides utilization, LacI family
*
Streptomyces avermitilis MA-4680

Site:
position = -92
score = 6.93314
sequence = TTATGTTTACGTAAACATCT

Gene: SAV_1031: Putative transcriptional regulator for beta-galactosides utilization, LacI family
Putative transcriptional regulator for beta-galactosides utilization, LacI family
 
CRON 2.
bgaZ
 
Streptomyces scabiei 87.22
 
Streptomyces griseus subsp. griseus NBRC 13350
*
Streptomyces coelicolor A3(2)

Site:
position = -101
score = 6.93314
sequence = AGATGTTTACGTAAACATAA

Site:
position = -56
score = 7.09567
sequence = TCATGTTTACGTAAACATCA

Gene: SCO7410: Putative beta-galactoside ABC transport system, permease component 1
*
Streptomyces avermitilis MA-4680

Site:
position = -110
score = 6.93314
sequence = AGATGTTTACGTAAACATAA

Gene: SAV_1030: Putative beta-galactoside ABC transport system, permease component 1
Putative beta-galactoside ABC transport system, permease component 1
bgaY
 
Streptomyces scabiei 87.22
 
Streptomyces griseus subsp. griseus NBRC 13350
 
Streptomyces coelicolor A3(2)

Gene: SCO7409: Putative beta-galactoside ABC transport system, permease component 2
 
Streptomyces avermitilis MA-4680

Gene: SAV_1029: Putative beta-galactoside ABC transport system, permease component 2
Putative beta-galactoside ABC transport system, permease component 2
bgaX
 
Streptomyces scabiei 87.22
 
Streptomyces griseus subsp. griseus NBRC 13350
 
Streptomyces coelicolor A3(2)

Gene: SCO7408: Putative beta-galactoside ABC transport system, periplasmic component
 
Streptomyces avermitilis MA-4680

Gene: SAV_1028: Putative beta-galactoside ABC transport system, periplasmic component
Putative beta-galactoside ABC transport system, periplasmic component
bgaB
 
Streptomyces scabiei 87.22
 
Streptomyces griseus subsp. griseus NBRC 13350
 
Streptomyces coelicolor A3(2)

Gene: SCO7407: Beta-galactosidase (EC 3.2.1.23)
 
Streptomyces avermitilis MA-4680

Gene: SAV_1027: Beta-galactosidase (EC 3.2.1.23)
Beta-galactosidase (EC 3.2.1.23)
gal6
*
Streptomyces scabiei 87.22

Site:
position = -186
score = 7.17867
sequence = GGATGTTTACGTAAACATCC

Gene: SCAB_43661: Endo-beta-1,6-galactanase
 
Streptomyces griseus subsp. griseus NBRC 13350
 
Streptomyces coelicolor A3(2)

Gene: SCO7406: Endo-beta-1,6-galactanase
 
Streptomyces avermitilis MA-4680

Gene: SAV_1026: Endo-beta-1,6-galactanase
Endo-beta-1,6-galactanase
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD