Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog IolR - Thermoanaerobacterales

Properties
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Inositol utilization
Effector:
Phylum: Firmicutes
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 7 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Thermoanaerobacter tengcongensis MB4 7 1
Thermoanaerobacter italicus Ab9 6 1
Thermoanaerobacter ethanolicus X514 7 1
Moorella thermoacetica ATCC 39073
Carboxydothermus hydrogenoformans Z-2901
Caldicellulosiruptor saccharolyticus DSM 8903 2 1
Anaerocellum thermophilum DSM 6725 2 1
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
iolR
*
Thermoanaerobacter tengcongensis MB4

Site:
position = -30
score = 6.16229
sequence = TTATGTAATCTGTTACATAG

Gene: TTE1952: Predicted inositol utilization transcriptional regulator IolR, LacI family
*
Thermoanaerobacter italicus Ab9

Site:
position = -29
score = 6.01275
sequence = TTATGTAATCTGTTACACAG

Gene: Thit_1753: Predicted inositol utilization transcriptional regulator IolR, LacI family
*
Thermoanaerobacter ethanolicus X514

Site:
position = -118
score = 4.69521
sequence = CTATGGGAGTGCTTAAATAC

Gene: Teth514_1072: Predicted inositol utilization transcriptional regulator IolR, LacI family
 
Moorella thermoacetica ATCC 39073
 
Carboxydothermus hydrogenoformans Z-2901
 
Caldicellulosiruptor saccharolyticus DSM 8903

Gene: Csac_1171: Predicted inositol utilization transcriptional regulator IolR, LacI family
 
Anaerocellum thermophilum DSM 6725

Gene: Athe_0343: Predicted inositol utilization transcriptional regulator IolR, LacI family
Predicted inositol utilization transcriptional regulator IolR, LacI family
iolG2
 
Thermoanaerobacter tengcongensis MB4

Gene: TTE1951: Myo-inositol 2-dehydrogenase 1 (EC 1.1.1.18)
 
Thermoanaerobacter italicus Ab9

Gene: Thit_1752: Myo-inositol 2-dehydrogenase 1 (EC 1.1.1.18)
 
Thermoanaerobacter ethanolicus X514

Gene: Teth514_1073: Myo-inositol 2-dehydrogenase 1 (EC 1.1.1.18)
 
Moorella thermoacetica ATCC 39073
 
Carboxydothermus hydrogenoformans Z-2901
 
Caldicellulosiruptor saccharolyticus DSM 8903
 
Anaerocellum thermophilum DSM 6725
Myo-inositol 2-dehydrogenase 1 (EC 1.1.1.18)
iolG1
 
Thermoanaerobacter tengcongensis MB4

Gene: TTE1950: Myo-inositol 2-dehydrogenase (EC 1.1.1.18)
 
Thermoanaerobacter italicus Ab9

Gene: Thit_1751: Myo-inositol 2-dehydrogenase (EC 1.1.1.18)
 
Thermoanaerobacter ethanolicus X514

Gene: Teth514_1074: Myo-inositol 2-dehydrogenase (EC 1.1.1.18)
 
Moorella thermoacetica ATCC 39073
 
Carboxydothermus hydrogenoformans Z-2901
 
Caldicellulosiruptor saccharolyticus DSM 8903
 
Anaerocellum thermophilum DSM 6725
Myo-inositol 2-dehydrogenase (EC 1.1.1.18)
iolE
 
Thermoanaerobacter tengcongensis MB4

Gene: TTE1949: Inosose dehydratase (EC 4.2.1.44)
 
Thermoanaerobacter italicus Ab9

Gene: Thit_1750: Inosose dehydratase (EC 4.2.1.44)
 
Thermoanaerobacter ethanolicus X514

Gene: Teth514_1075: Inosose dehydratase (EC 4.2.1.44)
 
Moorella thermoacetica ATCC 39073
 
Carboxydothermus hydrogenoformans Z-2901
 
Caldicellulosiruptor saccharolyticus DSM 8903
 
Anaerocellum thermophilum DSM 6725
Inosose dehydratase (EC 4.2.1.44)
iolI
 
Thermoanaerobacter tengcongensis MB4

Gene: TTE1948: Inosose isomerase (EC 5.3.99.-)
 
Thermoanaerobacter italicus Ab9

Gene: Thit_1749: Inosose isomerase (EC 5.3.99.-)
 
Thermoanaerobacter ethanolicus X514

Gene: Teth514_1076: Inosose isomerase (EC 5.3.99.-)
 
Moorella thermoacetica ATCC 39073
 
Carboxydothermus hydrogenoformans Z-2901
 
Caldicellulosiruptor saccharolyticus DSM 8903

Gene: Csac_1173: Inosose isomerase (EC 5.3.99.-)
 
Anaerocellum thermophilum DSM 6725

Gene: Athe_0345: Inosose isomerase (EC 5.3.99.-)
Inosose isomerase (EC 5.3.99.-)
iolT
 
Thermoanaerobacter tengcongensis MB4

Gene: TTE1947: Putative myo-inositol transporter
 
Thermoanaerobacter italicus Ab9
 
Thermoanaerobacter ethanolicus X514

Gene: Teth514_1077: Putative myo-inositol transporter
 
Moorella thermoacetica ATCC 39073
 
Carboxydothermus hydrogenoformans Z-2901
 
Caldicellulosiruptor saccharolyticus DSM 8903
 
Anaerocellum thermophilum DSM 6725
Putative myo-inositol transporter
gyaR
 
Thermoanaerobacter tengcongensis MB4

Gene: TTE1946: Putative glyoxylate reductase (EC 1.1.1.26)
 
Thermoanaerobacter italicus Ab9

Gene: Thit_1748: Putative glyoxylate reductase (EC 1.1.1.26)
 
Thermoanaerobacter ethanolicus X514

Gene: Teth514_1078: Putative glyoxylate reductase (EC 1.1.1.26)
 
Moorella thermoacetica ATCC 39073
 
Carboxydothermus hydrogenoformans Z-2901
 
Caldicellulosiruptor saccharolyticus DSM 8903
 
Anaerocellum thermophilum DSM 6725
Putative glyoxylate reductase (EC 1.1.1.26)
iolG3
 
Thermoanaerobacter tengcongensis MB4
 
Thermoanaerobacter italicus Ab9
 
Thermoanaerobacter ethanolicus X514
 
Moorella thermoacetica ATCC 39073
 
Carboxydothermus hydrogenoformans Z-2901
*
Caldicellulosiruptor saccharolyticus DSM 8903

Site:
position = -38
score = 5.99236
sequence = TTATGTAATCAATTACACTA

Site:
position = -72
score = 4.78082
sequence = CGTTGTAATTGATTACACTA

Gene: Csac_1172: Myo-inositol 2-dehydrogenase (EC 1.1.1.18)
*
Anaerocellum thermophilum DSM 6725

Site:
position = -72
score = 5.0022
sequence = CATTGTAATTGATTACACTA

Site:
position = -38
score = 6.09944
sequence = ATATGTAATCAATTACACAA

Gene: Athe_0344: Myo-inositol 2-dehydrogenase (EC 1.1.1.18)
Myo-inositol 2-dehydrogenase (EC 1.1.1.18)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD