Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog RbsR - Clostridia-1

Properties
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Ribose utilization
Effector: Ribose
Phylum: Firmicutes
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 5 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Clostridium acetobutylicum ATCC 824
Clostridium beijerincki NCIMB 8052
Clostridium botulinum A str. ATCC 3502
Clostridium butyricum 5521 7 1
Clostridium kluyveri DSM 555
Clostridium novyi NT 6 1
Clostridium perfringens ATCC 13124 4 1
Clostridium tetani E88 6 1
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
rbsD
 
Clostridium acetobutylicum ATCC 824
 
Clostridium beijerincki NCIMB 8052
 
Clostridium botulinum A str. ATCC 3502
*
Clostridium butyricum 5521

Site:
position = -120
score = 4.5724
sequence = TAATAGAAGCAGTTAAATTT

Gene: CBY_2443: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)
 
Clostridium kluyveri DSM 555
 
Clostridium novyi NT

Gene: NT01CX_0165: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)
 
Clostridium perfringens ATCC 13124

Gene: CPF_1883: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)
 
Clostridium tetani E88

Gene: CTC02351: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)
D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)
rbsA
 
Clostridium acetobutylicum ATCC 824
 
Clostridium beijerincki NCIMB 8052
 
Clostridium botulinum A str. ATCC 3502
 
Clostridium butyricum 5521

Gene: CBY_2442: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1)
 
Clostridium kluyveri DSM 555
 
Clostridium novyi NT

Gene: NT01CX_0164: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1)
 
Clostridium perfringens ATCC 13124

Gene: CPF_1882: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1)
 
Clostridium tetani E88

Gene: CTC02350: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1)
Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1)
rbsC
 
Clostridium acetobutylicum ATCC 824
 
Clostridium beijerincki NCIMB 8052
 
Clostridium botulinum A str. ATCC 3502
 
Clostridium butyricum 5521

Gene: CBY_2441: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1)
 
Clostridium kluyveri DSM 555
 
Clostridium novyi NT

Gene: NT01CX_0163: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1)
 
Clostridium perfringens ATCC 13124

Gene: CPF_1881: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1)
 
Clostridium tetani E88

Gene: CTC02349: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1)
Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1)
rbsB
 
Clostridium acetobutylicum ATCC 824
 
Clostridium beijerincki NCIMB 8052
 
Clostridium botulinum A str. ATCC 3502
 
Clostridium butyricum 5521

Gene: CBY_2440: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1)
 
Clostridium kluyveri DSM 555
 
Clostridium novyi NT

Gene: NT01CX_0162: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1)
 
Clostridium perfringens ATCC 13124
 
Clostridium tetani E88

Gene: CTC02347: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1)
Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1)
tal
 
Clostridium acetobutylicum ATCC 824
 
Clostridium beijerincki NCIMB 8052
 
Clostridium botulinum A str. ATCC 3502
 
Clostridium butyricum 5521

Gene: CBY_2439: transaldolase
 
Clostridium kluyveri DSM 555
 
Clostridium novyi NT
 
Clostridium perfringens ATCC 13124
 
Clostridium tetani E88
transaldolase
tkt
 
Clostridium acetobutylicum ATCC 824
 
Clostridium beijerincki NCIMB 8052
 
Clostridium botulinum A str. ATCC 3502
 
Clostridium butyricum 5521

Gene: CBY_2438: transketolase
 
Clostridium kluyveri DSM 555
 
Clostridium novyi NT
 
Clostridium perfringens ATCC 13124
 
Clostridium tetani E88
transketolase
rbsR
 
Clostridium acetobutylicum ATCC 824
 
Clostridium beijerincki NCIMB 8052
 
Clostridium botulinum A str. ATCC 3502
 
Clostridium butyricum 5521

Gene: CBY_2437: Ribose operon transcriptional regulator, LacI family
 
Clostridium kluyveri DSM 555
 
Clostridium novyi NT

Gene: NT01CX_0161: Ribose operon transcriptional regulator, LacI family
 
Clostridium perfringens ATCC 13124

Gene: CPF_1879: Ribose operon transcriptional regulator, LacI family
 
Clostridium tetani E88

Gene: CTC02346: Ribose operon transcriptional regulator, LacI family
Ribose operon transcriptional regulator, LacI family
rbsK
 
Clostridium acetobutylicum ATCC 824
 
Clostridium beijerincki NCIMB 8052
 
Clostridium botulinum A str. ATCC 3502
 
Clostridium butyricum 5521
 
Clostridium kluyveri DSM 555
*
Clostridium novyi NT

Site:
position = -65
score = 6.50822
sequence = TAATTTAACCGGTTAAATTA

Gene: NT01CX_0166: Ribokinase (EC 2.7.1.15)
*
Clostridium perfringens ATCC 13124

Site:
position = -45
score = 4.91967
sequence = CTAGTTAATCGGTTCACTGA

Site:
position = -32
score = 6.50822
sequence = TCACTGAATCGGTTAACTAG

Gene: CPF_1884: Ribokinase (EC 2.7.1.15)
*
Clostridium tetani E88

Site:
position = -37
score = 6.76527
sequence = TTAGTGAACCGGTTAAGTAA

Gene: CTC02352: Ribokinase (EC 2.7.1.15)
Ribokinase (EC 2.7.1.15)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD