Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog RhaR - Streptomycetaceae

Properties
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Rhamnose utilization
Effector: Rhamnose
Phylum: Actinobacteria
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 14 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Streptomyces avermitilis MA-4680 18 4
Streptomyces coelicolor A3(2) 20 6
Streptomyces griseus subsp. griseus NBRC 13350
Streptomyces scabiei 87.22 19 4
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
rhaI
*
Streptomyces avermitilis MA-4680

Site:
position = -56
score = 5.8925
sequence = CTCCTGAATCGTTTCATACG

Gene: SAV_7415: L-rhamnose isomerase (EC 5.3.1.14)
*
Streptomyces coelicolor A3(2)

Site:
position = -68
score = 6.0716
sequence = GTTCTGAATCGTTTCACACA

Gene: SCO0812: L-rhamnose isomerase (EC 5.3.1.14)
 
Streptomyces griseus subsp. griseus NBRC 13350
*
Streptomyces scabiei 87.22

Site:
position = -43
score = 6.24182
sequence = TTGCTGAATCGTTTCAGACA

Gene: SCAB_9441: L-rhamnose isomerase (EC 5.3.1.14)
L-rhamnose isomerase (EC 5.3.1.14)
rhaEW
 
Streptomyces avermitilis MA-4680

Gene: SAV_7414: Rhamnulose-1-phosphate aldolase (EC 4.1.2.19) / Lactaldehyde dehydrogenase (EC 1.2.1.22)
 
Streptomyces coelicolor A3(2)

Gene: SCO0813: Rhamnulose-1-phosphate aldolase (EC 4.1.2.19) / Lactaldehyde dehydrogenase (EC 1.2.1.22)
 
Streptomyces griseus subsp. griseus NBRC 13350
 
Streptomyces scabiei 87.22

Gene: SCAB_9451: Rhamnulose-1-phosphate aldolase (EC 4.1.2.19) / Lactaldehyde dehydrogenase (EC 1.2.1.22)
Rhamnulose-1-phosphate aldolase (EC 4.1.2.19) / Lactaldehyde dehydrogenase (EC 1.2.1.22)
rhaB
 
Streptomyces avermitilis MA-4680

Gene: SAV_7413: Rhamnulokinase (EC 2.7.1.5)
 
Streptomyces coelicolor A3(2)

Gene: SCO0814: Rhamnulokinase (EC 2.7.1.5)
 
Streptomyces griseus subsp. griseus NBRC 13350
 
Streptomyces scabiei 87.22

Gene: SCAB_9461: Rhamnulokinase (EC 2.7.1.5)
Rhamnulokinase (EC 2.7.1.5)
lldE
 
Streptomyces avermitilis MA-4680

Gene: SAV_7412: L-lactate dehydrogenase, Fe-S oxidoreductase subunit
 
Streptomyces coelicolor A3(2)

Gene: SCO0815: L-lactate dehydrogenase, Fe-S oxidoreductase subunit
 
Streptomyces griseus subsp. griseus NBRC 13350

Gene: SGR_795: L-lactate dehydrogenase, Fe-S oxidoreductase subunit
 
Streptomyces scabiei 87.22

Gene: SCAB_9471: L-lactate dehydrogenase, Fe-S oxidoreductase subunit
L-lactate dehydrogenase, Fe-S oxidoreductase subunit
lldF
 
Streptomyces avermitilis MA-4680

Gene: SAV_7411: L-lactate dehydrogenase, iron-sulfur cluster-binding subunit
 
Streptomyces coelicolor A3(2)

Gene: SCO0816: L-lactate dehydrogenase, iron-sulfur cluster-binding subunit
 
Streptomyces griseus subsp. griseus NBRC 13350

Gene: SGR_796: L-lactate dehydrogenase, iron-sulfur cluster-binding subunit
 
Streptomyces scabiei 87.22

Gene: SCAB_9481: L-lactate dehydrogenase, iron-sulfur cluster-binding subunit
L-lactate dehydrogenase, iron-sulfur cluster-binding subunit
lldG
 
Streptomyces avermitilis MA-4680

Gene: SAV_7410: L-lactate dehydrogenase, hypothetical subunit
 
Streptomyces coelicolor A3(2)

Gene: SCO0817: L-lactate dehydrogenase, hypothetical subunit
 
Streptomyces griseus subsp. griseus NBRC 13350

Gene: SGR_797: L-lactate dehydrogenase, hypothetical subunit
 
Streptomyces scabiei 87.22

Gene: SCAB_9491: L-lactate dehydrogenase, hypothetical subunit
L-lactate dehydrogenase, hypothetical subunit
 
CRON 2.
rhaG
*
Streptomyces avermitilis MA-4680

Site:
position = -225
score = 5.8925
sequence = CGTATGAAACGATTCAGGAG

Gene: SAV_7416: L-rhamnose ABC transporter, duplicated ATP-binding component
*
Streptomyces coelicolor A3(2)

Site:
position = -228
score = 6.0716
sequence = TGTGTGAAACGATTCAGAAC

Gene: SCO0811: L-rhamnose ABC transporter, duplicated ATP-binding component
 
Streptomyces griseus subsp. griseus NBRC 13350
*
Streptomyces scabiei 87.22

Site:
position = -235
score = 6.24182
sequence = TGTCTGAAACGATTCAGCAA

Gene: SCAB_9431: L-rhamnose ABC transporter, duplicated ATP-binding component
L-rhamnose ABC transporter, duplicated ATP-binding component
rhaH
 
Streptomyces avermitilis MA-4680

Gene: SAV_7417: L-rhamnose ABC transporter, permease component 1
 
Streptomyces coelicolor A3(2)

Gene: SCO0810: L-rhamnose ABC transporter, permease component 1
 
Streptomyces griseus subsp. griseus NBRC 13350
 
Streptomyces scabiei 87.22

Gene: SCAB_9421: L-rhamnose ABC transporter, permease component 1
L-rhamnose ABC transporter, permease component 1
rhaJ
 
Streptomyces avermitilis MA-4680

Gene: SAV_7418: L-rhamnose ABC transporter, permease component 2
 
Streptomyces coelicolor A3(2)

Gene: SCO0809: L-rhamnose ABC transporter, permease component 2
 
Streptomyces griseus subsp. griseus NBRC 13350
 
Streptomyces scabiei 87.22

Gene: SCAB_9411: L-rhamnose ABC transporter, permease component 2
L-rhamnose ABC transporter, permease component 2
rhaF
 
Streptomyces avermitilis MA-4680

Gene: SAV_7419: L-rhamnose ABC transporter, periplasmic rhamnose-binding protein
 
Streptomyces coelicolor A3(2)

Gene: SCO0808: L-rhamnose ABC transporter, periplasmic rhamnose-binding protein
 
Streptomyces griseus subsp. griseus NBRC 13350
 
Streptomyces scabiei 87.22

Gene: SCAB_9401: L-rhamnose ABC transporter, periplasmic rhamnose-binding protein
L-rhamnose ABC transporter, periplasmic rhamnose-binding protein
rhaM
 
Streptomyces avermitilis MA-4680

Gene: SAV_7420: L-rhamnose mutarotase
 
Streptomyces coelicolor A3(2)

Gene: SCO0807: L-rhamnose mutarotase
 
Streptomyces griseus subsp. griseus NBRC 13350
 
Streptomyces scabiei 87.22

Gene: SCAB_9391: L-rhamnose mutarotase
L-rhamnose mutarotase
rhaX
 
Streptomyces avermitilis MA-4680

Gene: SAV_7421: Putative rhamnoside hydrolase
 
Streptomyces coelicolor A3(2)
 
Streptomyces griseus subsp. griseus NBRC 13350
 
Streptomyces scabiei 87.22

Gene: SCAB_9381: Putative rhamnoside hydrolase
Putative rhamnoside hydrolase
rhaR
 
Streptomyces avermitilis MA-4680

Gene: SAV_7422: Rhamnose utilization transcriptional regulator RhaR, LacI family
 
Streptomyces coelicolor A3(2)

Gene: SCO0806: Rhamnose utilization transcriptional regulator RhaR, LacI family
 
Streptomyces griseus subsp. griseus NBRC 13350
 
Streptomyces scabiei 87.22

Gene: SCAB_9371: Rhamnose utilization transcriptional regulator RhaR, LacI family
Rhamnose utilization transcriptional regulator RhaR, LacI family
 
CRON 3.
rhmA3
 
Streptomyces avermitilis MA-4680
*
Streptomyces coelicolor A3(2)

Site:
position = 22
score = 4.89092
sequence = CGGTTGAAACGTTTCAAGCG

Gene: SCO0488: putative rhamnosidase
 
Streptomyces griseus subsp. griseus NBRC 13350
 
Streptomyces scabiei 87.22
putative rhamnosidase
 
CRON 4.
SCF41.30c
 
Streptomyces avermitilis MA-4680
*
Streptomyces coelicolor A3(2)

Site:
position = -41
score = 4.03855
sequence = CGAGTAAAACGATTCAATCG

Gene: SCO0371: COG3533 secreted protein
 
Streptomyces griseus subsp. griseus NBRC 13350
 
Streptomyces scabiei 87.22
COG3533 secreted protein
SCF41.29c
 
Streptomyces avermitilis MA-4680
 
Streptomyces coelicolor A3(2)

Gene: SCO0370: Predicted alpha-L-rhamnosidase
 
Streptomyces griseus subsp. griseus NBRC 13350
 
Streptomyces scabiei 87.22
Predicted alpha-L-rhamnosidase
SCF41.28c
 
Streptomyces avermitilis MA-4680
 
Streptomyces coelicolor A3(2)

Gene: SCO0369: putative secreted protein
 
Streptomyces griseus subsp. griseus NBRC 13350
*
Streptomyces scabiei 87.22

Site:
position = -54
score = 4.11198
sequence = GTGATGAAACGTTTTAATCC

Gene: SCAB_86701: putative secreted protein
putative secreted protein
SCAB_86711
 
Streptomyces avermitilis MA-4680
 
Streptomyces coelicolor A3(2)
 
Streptomyces griseus subsp. griseus NBRC 13350
 
Streptomyces scabiei 87.22

Gene: SCAB_86711: putative exported rhamnosidase A
putative exported rhamnosidase A
 
CRON 5.
rhmA2
 
Streptomyces avermitilis MA-4680
*
Streptomyces coelicolor A3(2)

Site:
position = -53
score = 4.28657
sequence = GGATTGAATCGATTCAATCA

Gene: SCO0372: Predicted alpha-L-rhamnosidase
 
Streptomyces griseus subsp. griseus NBRC 13350
 
Streptomyces scabiei 87.22

Gene: SCAB_77201: Predicted alpha-L-rhamnosidase
Predicted alpha-L-rhamnosidase
 
CRON 6.
rhmA
*
Streptomyces avermitilis MA-4680

Site:
position = -155
score = 4.27671
sequence = GCTGTGAATCGATTCACCTT

Gene: SAV_828: rhamnosidase
 
Streptomyces coelicolor A3(2)
 
Streptomyces griseus subsp. griseus NBRC 13350
 
Streptomyces scabiei 87.22
rhamnosidase
 
CRON 7.
rhiL
*
Streptomyces avermitilis MA-4680

Site:
position = -52
score = 4.68169
sequence = TACTTGAAACGATTCATGAC

Gene: SAV_6812: Putatuve rhamnogalacturonides ABC transporter, substrate-binding protein
*
Streptomyces coelicolor A3(2)

Site:
position = -48
score = 4.78631
sequence = TACTTGAAACGATTCATGAG

Gene: SCO1539: Putatuve rhamnogalacturonides ABC transporter, substrate-binding protein
 
Streptomyces griseus subsp. griseus NBRC 13350
*
Streptomyces scabiei 87.22

Site:
position = -50
score = 4.2288
sequence = TACTTGAAACGATTCACGGC

Gene: SCAB_74641: Putatuve rhamnogalacturonides ABC transporter, substrate-binding protein
Putatuve rhamnogalacturonides ABC transporter, substrate-binding protein
rhiF
 
Streptomyces avermitilis MA-4680

Gene: SAV_6813: Putatuve rhamnogalacturonides ABC transporter, permease component 1
 
Streptomyces coelicolor A3(2)

Gene: SCO1538: Putatuve rhamnogalacturonides ABC transporter, permease component 1
 
Streptomyces griseus subsp. griseus NBRC 13350
 
Streptomyces scabiei 87.22

Gene: SCAB_74651: Putatuve rhamnogalacturonides ABC transporter, permease component 1
Putatuve rhamnogalacturonides ABC transporter, permease component 1
rhiG
 
Streptomyces avermitilis MA-4680

Gene: SAV_6814: Putatuve rhamnogalacturonides ABC transporter, permease component 2
 
Streptomyces coelicolor A3(2)

Gene: SCO1537: Putatuve rhamnogalacturonides ABC transporter, permease component 2
 
Streptomyces griseus subsp. griseus NBRC 13350
 
Streptomyces scabiei 87.22

Gene: SCAB_74661: Putatuve rhamnogalacturonides ABC transporter, permease component 2
Putatuve rhamnogalacturonides ABC transporter, permease component 2
SAV_6815
 
Streptomyces avermitilis MA-4680

Gene: SAV_6815: hypothetical protein
 
Streptomyces coelicolor A3(2)
 
Streptomyces griseus subsp. griseus NBRC 13350
 
Streptomyces scabiei 87.22

Gene: SCAB_74671: hypothetical protein
hypothetical protein
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD