Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog Bphy_4590 - Burkholderia

Properties
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Sugar utilization
Effector:
Phylum: Proteobacteria/beta
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 10 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Burkholderia cepacia AMMD 4 2
Burkholderia glumae BGR1 4 1
Burkholderia mallei ATCC 23344
Burkholderia phymatum STM815 4 2
Burkholderia pseudomallei K96243
Burkholderia sp. 383 4 2
Burkholderia vietnamiensis G4 4 2
Burkholderia xenovorans LB400
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
Bphy_4591
*
Burkholderia cepacia AMMD

Site:
position = -21
score = 6.70009
sequence = AAATGTAAGCGGTTACATTC

Gene: Bamb_1343: Predicted sugar kinase
*
Burkholderia glumae BGR1

Site:
position = -49
score = 6.10819
sequence = AAATGTAAGCGCTAACATCA

Site:
position = -125
score = 6.69218
sequence = CCATGTAAGCGCTAACATTT

Gene: bglu_2g08900: Predicted sugar kinase
 
Burkholderia mallei ATCC 23344
*
Burkholderia phymatum STM815

Site:
position = -134
score = 6.39628
sequence = AGATGTAAGCGCTAACATTA

Gene: Bphy_4591: Predicted sugar kinase
 
Burkholderia pseudomallei K96243
*
Burkholderia sp. 383

Site:
position = -24
score = 6.79746
sequence = AAATGTAAGCGATTACATTC

Gene: Bcep18194_C7623: Predicted sugar kinase
*
Burkholderia vietnamiensis G4

Site:
position = -21
score = 6.70009
sequence = AAATGTAAGCGATTACATTG

Gene: Bcep1808_1423: Predicted sugar kinase
 
Burkholderia xenovorans LB400
Predicted sugar kinase
Bphy_4592
 
Burkholderia cepacia AMMD

Gene: Bamb_1344: Predicted sugar transporter
 
Burkholderia glumae BGR1

Gene: bglu_2g08890: Predicted sugar transporter
 
Burkholderia mallei ATCC 23344
 
Burkholderia phymatum STM815

Gene: Bphy_4592: Predicted sugar transporter
 
Burkholderia pseudomallei K96243
 
Burkholderia sp. 383

Gene: Bcep18194_C7622: Predicted sugar transporter
 
Burkholderia vietnamiensis G4

Gene: Bcep1808_1424: Predicted sugar transporter
 
Burkholderia xenovorans LB400
Predicted sugar transporter
COG0329
 
Burkholderia cepacia AMMD

Gene: Bamb_1345: predited dihydrodipicolinate synthase/N-acetylneuraminate lyase family protein
 
Burkholderia glumae BGR1

Gene: bglu_2g08880: predited dihydrodipicolinate synthase/N-acetylneuraminate lyase family protein
 
Burkholderia mallei ATCC 23344
 
Burkholderia phymatum STM815

Gene: Bphy_4593: predited dihydrodipicolinate synthase/N-acetylneuraminate lyase family protein
 
Burkholderia pseudomallei K96243
 
Burkholderia sp. 383

Gene: Bcep18194_C7621: predited dihydrodipicolinate synthase/N-acetylneuraminate lyase family protein
 
Burkholderia vietnamiensis G4

Gene: Bcep1808_1425: predited dihydrodipicolinate synthase/N-acetylneuraminate lyase family protein
 
Burkholderia xenovorans LB400
predited dihydrodipicolinate synthase/N-acetylneuraminate lyase family protein
Bphy_4590
*
Burkholderia cepacia AMMD

Site:
position = -237
score = 6.73772
sequence = GAATGTAACCGCTTACATTT

Gene: Bamb_1342: Predicted transcriptional regulator, LacI family
 
Burkholderia glumae BGR1

Gene: bglu_2g08870: Predicted transcriptional regulator, LacI family
 
Burkholderia mallei ATCC 23344
*
Burkholderia phymatum STM815

Site:
position = -218
score = 6.24425
sequence = CCGTGTTAGCGCTTACATTT

Gene: Bphy_4590: Predicted transcriptional regulator, LacI family
 
Burkholderia pseudomallei K96243
*
Burkholderia sp. 383

Site:
position = -237
score = 6.83509
sequence = GAATGTAATCGCTTACATTT

Gene: Bcep18194_C7624: Predicted transcriptional regulator, LacI family
*
Burkholderia vietnamiensis G4

Site:
position = -240
score = 6.89863
sequence = CAATGTAATCGCTTACATTT

Gene: Bcep1808_1422: Predicted transcriptional regulator, LacI family
 
Burkholderia xenovorans LB400
Predicted transcriptional regulator, LacI family
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD