Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog ManR - Streptomycetaceae

Properties
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Mannosides utilization; Mannose utilization
Effector: Mannose
Phylum: Actinobacteria
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 15 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Streptomyces avermitilis MA-4680 4 4
Streptomyces coelicolor A3(2) 6 5
Streptomyces griseus subsp. griseus NBRC 13350 3 3
Streptomyces scabiei 87.22 3 2
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
manA
*
Streptomyces avermitilis MA-4680

Site:
position = -51
score = 5.65262
sequence = AGTTGACAACGTTGTCCATT

Gene: SAV_2252: Alpha-1,2-mannosidase
*
Streptomyces coelicolor A3(2)

Site:
position = -42
score = 5.93695
sequence = ATTTGACAACGTTGTCCCAC

Gene: SCO6004: Alpha-1,2-mannosidase
*
Streptomyces griseus subsp. griseus NBRC 13350

Site:
position = -47
score = 6.19416
sequence = CTATGACAACGTTGTCCAGG

Gene: SGR_1503: Alpha-1,2-mannosidase
 
Streptomyces scabiei 87.22

Gene: SCAB_21071: Alpha-1,2-mannosidase
Alpha-1,2-mannosidase
 
CRON 2.
SCO6428
 
Streptomyces avermitilis MA-4680
*
Streptomyces coelicolor A3(2)

Site:
position = -41
score = 6.35152
sequence = GCTTGACAACGTTGTCCACC

Gene: SCO6428: putative secreted protein
 
Streptomyces griseus subsp. griseus NBRC 13350
 
Streptomyces scabiei 87.22
putative secreted protein
 
CRON 3.
manA2
 
Streptomyces avermitilis MA-4680
*
Streptomyces coelicolor A3(2)

Site:
position = -49
score = 6.09278
sequence = GCGGGACAACGTTGTCAGGT

Gene: SCO6234: secreted beta-mannosidase
 
Streptomyces griseus subsp. griseus NBRC 13350
 
Streptomyces scabiei 87.22

Gene: SCAB_82021: secreted beta-mannosidase
secreted beta-mannosidase
 
CRON 4.
manA3
*
Streptomyces avermitilis MA-4680

Site:
position = -164
score = 4.82656
sequence = AACCGACAACGATGTCAAGC

Site:
position = -210
score = 5.10664
sequence = CGGCGACAACGTTGTCTGAG

Gene: SAV_2253: Alpha-1,2-mannosidase
 
Streptomyces coelicolor A3(2)
 
Streptomyces griseus subsp. griseus NBRC 13350
 
Streptomyces scabiei 87.22
Alpha-1,2-mannosidase
 
CRON 5.
manR
*
Streptomyces avermitilis MA-4680

Site:
position = -99
score = 6.415
sequence = GTCTGACAACGTTGTCCAGG

Gene: SAV_1477: Predicted mannoside utilization transcriptional regulator, LacI family
*
Streptomyces coelicolor A3(2)

Site:
position = -125
score = 6.31209
sequence = ATCTGACAACGTTGTCCAGG

Gene: SCO1078: Predicted mannoside utilization transcriptional regulator, LacI family
*
Streptomyces griseus subsp. griseus NBRC 13350

Site:
position = -133
score = 6.36501
sequence = TGTTGACAACGTTGTCCAGG

Gene: SGR_6529: Predicted mannoside utilization transcriptional regulator, LacI family
*
Streptomyces scabiei 87.22

Site:
position = -112
score = 6.46792
sequence = GCGTGACAACGTTGTCCAGG

Gene: SCAB_82731: Predicted mannoside utilization transcriptional regulator, LacI family
Predicted mannoside utilization transcriptional regulator, LacI family
SCO1079
 
Streptomyces avermitilis MA-4680
 
Streptomyces coelicolor A3(2)

Gene: SCO1079: Conserved hypothetical protein
 
Streptomyces griseus subsp. griseus NBRC 13350
 
Streptomyces scabiei 87.22

Gene: SCAB_82721: Conserved hypothetical protein
Conserved hypothetical protein
 
CRON 6.
manK
*
Streptomyces avermitilis MA-4680

Site:
position = -172
score = 6.415
sequence = CCTGGACAACGTTGTCAGAC

Gene: SAV_1476: Predicted mannokinase, ROK family
*
Streptomyces coelicolor A3(2)

Site:
position = -135
score = 6.31209
sequence = CCTGGACAACGTTGTCAGAT

Gene: SCO1077: Predicted mannokinase, ROK family
*
Streptomyces griseus subsp. griseus NBRC 13350

Site:
position = -93
score = 6.36501
sequence = CCTGGACAACGTTGTCAACA

Gene: SGR_6530: Predicted mannokinase, ROK family
*
Streptomyces scabiei 87.22

Site:
position = -76
score = 6.46792
sequence = CCTGGACAACGTTGTCACGC

Gene: SCAB_82741: Predicted mannokinase, ROK family
Predicted mannokinase, ROK family
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD