Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog SAV1329 - Streptomycetaceae

Properties
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Galactosides utilization
Effector: Beta-galactosides
Phylum: Actinobacteria
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 4 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Streptomyces avermitilis MA-4680 6 2
Streptomyces coelicolor A3(2)
Streptomyces griseus subsp. griseus NBRC 13350
Streptomyces scabiei 87.22 6 2
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
lacA
*
Streptomyces avermitilis MA-4680

Site:
position = -132
score = 7.14561
sequence = TTCTGTGAGCGTTCACAGTA

Gene: SAV_1325: Beta-galactosidase (EC 3.2.1.23)
 
Streptomyces coelicolor A3(2)
 
Streptomyces griseus subsp. griseus NBRC 13350
*
Streptomyces scabiei 87.22

Site:
position = -133
score = 7.14561
sequence = TTCTGTGAGCGTTCACAGTA

Gene: SCAB_83491: Beta-galactosidase (EC 3.2.1.23)
Beta-galactosidase (EC 3.2.1.23)
ganA
 
Streptomyces avermitilis MA-4680

Gene: SAV_1324: Arabinogalactan endo-1,4-beta-galactosidase (EC 3.2.1.89)
 
Streptomyces coelicolor A3(2)
 
Streptomyces griseus subsp. griseus NBRC 13350
 
Streptomyces scabiei 87.22

Gene: SCAB_83501: Arabinogalactan endo-1,4-beta-galactosidase (EC 3.2.1.89)
Arabinogalactan endo-1,4-beta-galactosidase (EC 3.2.1.89)
 
CRON 2.
SAV_1326
*
Streptomyces avermitilis MA-4680

Site:
position = -73
score = 7.14561
sequence = TACTGTGAACGCTCACAGAA

Gene: SAV_1326: Predicted galactosides ABC transporter, substrate-binding protein
 
Streptomyces coelicolor A3(2)
 
Streptomyces griseus subsp. griseus NBRC 13350
*
Streptomyces scabiei 87.22

Site:
position = -73
score = 7.14561
sequence = TACTGTGAACGCTCACAGAA

Gene: SCAB_83481: Predicted galactosides ABC transporter, substrate-binding protein
Predicted galactosides ABC transporter, substrate-binding protein
SAV_1327
 
Streptomyces avermitilis MA-4680

Gene: SAV_1327: Predicted galactosides ABC transporter, permease protein 1
 
Streptomyces coelicolor A3(2)
 
Streptomyces griseus subsp. griseus NBRC 13350
 
Streptomyces scabiei 87.22

Gene: SCAB_83471: Predicted galactosides ABC transporter, permease protein 1
Predicted galactosides ABC transporter, permease protein 1
SAV_1328
 
Streptomyces avermitilis MA-4680

Gene: SAV_1328: Predicted galactosides ABC transporter, permease protein 2
 
Streptomyces coelicolor A3(2)
 
Streptomyces griseus subsp. griseus NBRC 13350
 
Streptomyces scabiei 87.22

Gene: SCAB_83461: Predicted galactosides ABC transporter, permease protein 2
Predicted galactosides ABC transporter, permease protein 2
SAV_1329
 
Streptomyces avermitilis MA-4680

Gene: SAV_1329: Predicted galactosides utilization transcriptional regulator, LacI-family
 
Streptomyces coelicolor A3(2)
 
Streptomyces griseus subsp. griseus NBRC 13350
 
Streptomyces scabiei 87.22

Gene: SCAB_83451: Predicted galactosides utilization transcriptional regulator, LacI-family
Predicted galactosides utilization transcriptional regulator, LacI-family
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD