Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog SgaR - Vibrionales

Properties
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Ascorbate utilization
Effector: Ascorbate-6-phosphate
Phylum: Proteobacteria/gamma
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 12 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Photobacterium profundum SS9
Vibrio angustum S14
Vibrio cholerae O1 biovar eltor str. N16961
Vibrio fischeri ES114
Vibrio harveyi ATCC BAA-1116
Vibrio parahaemolyticus RIMD 2210633 4 2
Vibrio salmonicida LFI1238
Vibrio shilonii AK1
Vibrio splendidus LGP32
Vibrio vulnificus CMCP6 4 2
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
sgaR
 
Photobacterium profundum SS9
 
Vibrio angustum S14
 
Vibrio cholerae O1 biovar eltor str. N16961
 
Vibrio fischeri ES114
 
Vibrio harveyi ATCC BAA-1116
*
Vibrio parahaemolyticus RIMD 2210633

Site:
position = -138
score = 5.94925
sequence = TTGTGATAGCGCTATCATTT

Site:
position = -159
score = 6.29702
sequence = ATCTGATAGCGCTACCATTA

Site:
position = -172
score = 6.29702
sequence = AAATGGTAGCGCTATCTGAT

Gene: VPA0232: Ascorbate utilization transcriptional regulator SgaR, LacI family
 
Vibrio salmonicida LFI1238
 
Vibrio shilonii AK1
 
Vibrio splendidus LGP32
*
Vibrio vulnificus CMCP6

Site:
position = -134
score = 5.54272
sequence = GTGTGATAGCGCTACCATTT

Site:
position = -155
score = 6.22002
sequence = ACCTGATAGCGCTATCATTA

Site:
position = -168
score = 6.29702
sequence = AAATGATAGCGCTACCTGAT

Gene: VV20859: Ascorbate utilization transcriptional regulator SgaR, LacI family
Ascorbate utilization transcriptional regulator SgaR, LacI family
 
CRON 2.
sgaA
 
Photobacterium profundum SS9
 
Vibrio angustum S14
 
Vibrio cholerae O1 biovar eltor str. N16961
 
Vibrio fischeri ES114
 
Vibrio harveyi ATCC BAA-1116
*
Vibrio parahaemolyticus RIMD 2210633

Site:
position = -131
score = 5.94925
sequence = AAATGATAGCGCTATCACAA

Site:
position = -110
score = 6.29702
sequence = TAATGGTAGCGCTATCAGAT

Site:
position = -97
score = 6.29702
sequence = ATCAGATAGCGCTACCATTT

Gene: VPA0231: Ascorbate-specific PTS system, EIIA component (EC 2.7.1.-)
 
Vibrio salmonicida LFI1238
 
Vibrio shilonii AK1
 
Vibrio splendidus LGP32
*
Vibrio vulnificus CMCP6

Site:
position = -97
score = 6.29702
sequence = ATCAGGTAGCGCTATCATTT

Site:
position = -110
score = 6.22002
sequence = TAATGATAGCGCTATCAGGT

Site:
position = -131
score = 5.54272
sequence = AAATGGTAGCGCTATCACAC

Gene: VV20860: Ascorbate-specific PTS system, EIIA component (EC 2.7.1.-)
Ascorbate-specific PTS system, EIIA component (EC 2.7.1.-)
sgaB
 
Photobacterium profundum SS9
 
Vibrio angustum S14
 
Vibrio cholerae O1 biovar eltor str. N16961
 
Vibrio fischeri ES114
 
Vibrio harveyi ATCC BAA-1116
 
Vibrio parahaemolyticus RIMD 2210633

Gene: VPA0230: Ascorbate-specific PTS system, EIIB component (EC 2.7.1.69)
 
Vibrio salmonicida LFI1238
 
Vibrio shilonii AK1
 
Vibrio splendidus LGP32
 
Vibrio vulnificus CMCP6

Gene: VV20861: Ascorbate-specific PTS system, EIIB component (EC 2.7.1.69)
Ascorbate-specific PTS system, EIIB component (EC 2.7.1.69)
sgaT
 
Photobacterium profundum SS9
 
Vibrio angustum S14
 
Vibrio cholerae O1 biovar eltor str. N16961
 
Vibrio fischeri ES114
 
Vibrio harveyi ATCC BAA-1116
 
Vibrio parahaemolyticus RIMD 2210633

Gene: VPA0229: Ascorbate-specific PTS system, EIIC component
 
Vibrio salmonicida LFI1238
 
Vibrio shilonii AK1
 
Vibrio splendidus LGP32
 
Vibrio vulnificus CMCP6

Gene: VV2_0862: Ascorbate-specific PTS system, EIIC component
Ascorbate-specific PTS system, EIIC component
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD