Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog MalR1 - Clostridia-1

Properties
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Maltose utilization; Maltodextrin utilization
Effector: Maltose
Phylum: Firmicutes
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 4 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Clostridium acetobutylicum ATCC 824
Clostridium beijerincki NCIMB 8052 3 1
Clostridium botulinum A str. ATCC 3502
Clostridium butyricum 5521 3 1
Clostridium kluyveri DSM 555
Clostridium novyi NT 8 1
Clostridium perfringens ATCC 13124 4 1
Clostridium tetani E88
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
malR1
 
Clostridium acetobutylicum ATCC 824
*
Clostridium beijerincki NCIMB 8052

Site:
position = -53
score = 6.06376
sequence = TTAAGGTAACGATACCGAAC

Gene: Cbei_0863: Maltose/maltodextrin utilization transcriptional regulator MalR1, LacI family
 
Clostridium botulinum A str. ATCC 3502
*
Clostridium butyricum 5521

Site:
position = -50
score = 6.34051
sequence = GAACGGTACCGTTACCGAAT

Gene: CBY_3499: Maltose/maltodextrin utilization transcriptional regulator MalR1, LacI family
 
Clostridium kluyveri DSM 555
*
Clostridium novyi NT

Site:
position = -75
score = 6.10862
sequence = TACCAGTAACGTTTCCAAAA

Gene: NT01CX_0963: Maltose/maltodextrin utilization transcriptional regulator MalR1, LacI family
*
Clostridium perfringens ATCC 13124

Site:
position = -67
score = 6.34051
sequence = AACTGGTATCGTTACCGAAA

Gene: CPF_2649: Maltose/maltodextrin utilization transcriptional regulator MalR1, LacI family
 
Clostridium tetani E88
Maltose/maltodextrin utilization transcriptional regulator MalR1, LacI family
malK
 
Clostridium acetobutylicum ATCC 824
 
Clostridium beijerincki NCIMB 8052
 
Clostridium botulinum A str. ATCC 3502
 
Clostridium butyricum 5521
 
Clostridium kluyveri DSM 555
 
Clostridium novyi NT

Gene: NT01CX_0964: Maltose/maltodextrin transporter, ATP-binding protein
 
Clostridium perfringens ATCC 13124
 
Clostridium tetani E88
Maltose/maltodextrin transporter, ATP-binding protein
malE
 
Clostridium acetobutylicum ATCC 824
 
Clostridium beijerincki NCIMB 8052
 
Clostridium botulinum A str. ATCC 3502
 
Clostridium butyricum 5521
 
Clostridium kluyveri DSM 555
 
Clostridium novyi NT

Gene: NT01CX_0965: Maltose/maltodextrin ABC transporter, substrate-binding protein
 
Clostridium perfringens ATCC 13124
 
Clostridium tetani E88
Maltose/maltodextrin ABC transporter, substrate-binding protein
malF
 
Clostridium acetobutylicum ATCC 824
 
Clostridium beijerincki NCIMB 8052
 
Clostridium botulinum A str. ATCC 3502
 
Clostridium butyricum 5521
 
Clostridium kluyveri DSM 555
 
Clostridium novyi NT

Gene: NT01CX_0966: Maltose/maltodextrin ABC transporter, permease protein 2
 
Clostridium perfringens ATCC 13124
 
Clostridium tetani E88
Maltose/maltodextrin ABC transporter, permease protein 2
malG
 
Clostridium acetobutylicum ATCC 824
 
Clostridium beijerincki NCIMB 8052
 
Clostridium botulinum A str. ATCC 3502
 
Clostridium butyricum 5521
 
Clostridium kluyveri DSM 555
 
Clostridium novyi NT

Gene: NT01CX_0967: Maltose/maltodextrin ABC transporter, permease protein 1
 
Clostridium perfringens ATCC 13124
 
Clostridium tetani E88
Maltose/maltodextrin ABC transporter, permease protein 1
malZ
 
Clostridium acetobutylicum ATCC 824
 
Clostridium beijerincki NCIMB 8052
 
Clostridium botulinum A str. ATCC 3502
 
Clostridium butyricum 5521
 
Clostridium kluyveri DSM 555
 
Clostridium novyi NT

Gene: NT01CX_0968: Alpha-glucosidase (EC 3.2.1.20)
 
Clostridium perfringens ATCC 13124

Gene: CPF_2648: Alpha-glucosidase (EC 3.2.1.20)
 
Clostridium tetani E88
Alpha-glucosidase (EC 3.2.1.20)
malQ
 
Clostridium acetobutylicum ATCC 824
 
Clostridium beijerincki NCIMB 8052

Gene: Cbei_0864: 4-alpha-glucanotransferase (amylomaltase) (EC 2.4.1.25)
 
Clostridium botulinum A str. ATCC 3502
 
Clostridium butyricum 5521

Gene: CBY_3498: 4-alpha-glucanotransferase (amylomaltase) (EC 2.4.1.25)
 
Clostridium kluyveri DSM 555
 
Clostridium novyi NT

Gene: NT01CX_0969: 4-alpha-glucanotransferase (amylomaltase) (EC 2.4.1.25)
 
Clostridium perfringens ATCC 13124

Gene: CPF_2647: 4-alpha-glucanotransferase (amylomaltase) (EC 2.4.1.25)
 
Clostridium tetani E88
4-alpha-glucanotransferase (amylomaltase) (EC 2.4.1.25)
glgP
 
Clostridium acetobutylicum ATCC 824
 
Clostridium beijerincki NCIMB 8052

Gene: Cbei_0865: Maltodextrin phosphorylase (EC 2.4.1.1)
 
Clostridium botulinum A str. ATCC 3502
 
Clostridium butyricum 5521

Gene: CBY_3497: Maltodextrin phosphorylase (EC 2.4.1.1)
 
Clostridium kluyveri DSM 555
 
Clostridium novyi NT

Gene: NT01CX_0970: Maltodextrin phosphorylase (EC 2.4.1.1)
 
Clostridium perfringens ATCC 13124

Gene: CPF_2646: Maltodextrin phosphorylase (EC 2.4.1.1)
 
Clostridium tetani E88
Maltodextrin phosphorylase (EC 2.4.1.1)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD