Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog ManR - Xanthomonadales

Properties
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Mannosides utilization; Mannose utilization
Effector: Mannose
Phylum: Proteobacteria/gamma
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 13 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Stenotrophomonas maltophilia K279a 8 3
Xanthomonas axonopodis pv. citri str. 306 6 3
Xanthomonas campestris pv. campestris str. ATCC 33913 7 3
Xylella fastidiosa 9a5c
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
omp(Man)
*
Stenotrophomonas maltophilia K279a

Site:
position = -62
score = 5.71091
sequence = AAATTAGATCGATTCAAGTT

Site:
position = -183
score = 5.06757
sequence = CGCTTAGATCGATCCAAGAC

Gene: Smlt2179: Mannosides-regulated TonB-dependent outer membrane receptor
*
Xanthomonas axonopodis pv. citri str. 306

Site:
position = -229
score = 5.52997
sequence = GCATTAGAACGATCTAATCG

Site:
position = -117
score = 4.85937
sequence = TCGTTGGATCGATACAAAGC

Gene: XAC1910: Mannosides-regulated TonB-dependent outer membrane receptor
*
Xanthomonas campestris pv. campestris str. ATCC 33913

Site:
position = -231
score = 5.52997
sequence = GCATTAGAACGATCTAATCG

Site:
position = -118
score = 4.2504
sequence = TCGTTGGATGGATACAAAGC

Gene: XCC1892: Mannosides-regulated TonB-dependent outer membrane receptor
 
Xylella fastidiosa 9a5c
Mannosides-regulated TonB-dependent outer membrane receptor
 
CRON 2.
mnnA
*
Stenotrophomonas maltophilia K279a

Site:
position = -144
score = 5.57597
sequence = TACTTGAATCGATCTAAATT

Gene: Smlt2180: Alpha-1,2-mannosidase
*
Xanthomonas axonopodis pv. citri str. 306

Site:
position = -302
score = 5.66293
sequence = AGTTTAGATCGATCCAAGCC

Gene: XAC4355: Alpha-1,2-mannosidase
 
Xanthomonas campestris pv. campestris str. ATCC 33913

Gene: XCC4221: Alpha-1,2-mannosidase
 
Xylella fastidiosa 9a5c
Alpha-1,2-mannosidase
manR
 
Stenotrophomonas maltophilia K279a

Gene: Smlt2181: Mannose utilization transcriptional regulator ManR, LacI family
*
Xanthomonas axonopodis pv. citri str. 306

Site:
position = -90
score = 6.3178
sequence = TAATTGGATCGATCCAATTT

Gene: XAC1555: Mannose utilization transcriptional regulator ManR, LacI family
*
Xanthomonas campestris pv. campestris str. ATCC 33913

Site:
position = -132
score = 6.16696
sequence = TAATTGGATCGATCCAATCA

Gene: XCC1507: Mannose utilization transcriptional regulator ManR, LacI family
 
Xylella fastidiosa 9a5c
Mannose utilization transcriptional regulator ManR, LacI family
manP
 
Stenotrophomonas maltophilia K279a

Gene: Smlt2182: Predicted mannose transporter, GGP family
 
Xanthomonas axonopodis pv. citri str. 306

Gene: XAC1556: Predicted mannose transporter, GGP family
 
Xanthomonas campestris pv. campestris str. ATCC 33913

Gene: XCC1508: Predicted mannose transporter, GGP family
 
Xylella fastidiosa 9a5c

Gene: XF1609: Predicted mannose transporter, GGP family
Predicted mannose transporter, GGP family
manK2
 
Stenotrophomonas maltophilia K279a

Gene: Smlt2183: Fructokinase in mannoside utilization gene cluster (EC 2.7.1.4)
 
Xanthomonas axonopodis pv. citri str. 306

Gene: XAC1557: Fructokinase in mannoside utilization gene cluster (EC 2.7.1.4)
 
Xanthomonas campestris pv. campestris str. ATCC 33913

Gene: XCC1509: Fructokinase in mannoside utilization gene cluster (EC 2.7.1.4)
 
Xylella fastidiosa 9a5c

Gene: XF1610: Fructokinase in mannoside utilization gene cluster (EC 2.7.1.4)
Fructokinase in mannoside utilization gene cluster (EC 2.7.1.4)
manI2
 
Stenotrophomonas maltophilia K279a

Gene: Smlt2184: D-mannose isomerase (EC 5.3.1.7)
 
Xanthomonas axonopodis pv. citri str. 306

Gene: XAC1558: D-mannose isomerase (EC 5.3.1.7)
 
Xanthomonas campestris pv. campestris str. ATCC 33913

Gene: XCC1510: D-mannose isomerase (EC 5.3.1.7)
 
Xylella fastidiosa 9a5c

Gene: XF1611: D-mannose isomerase (EC 5.3.1.7)
D-mannose isomerase (EC 5.3.1.7)
mnnB
 
Stenotrophomonas maltophilia K279a

Gene: Smlt2185: Beta-mannosidase (EC 3.2.1.25)
 
Xanthomonas axonopodis pv. citri str. 306

Gene: XAC3075: Beta-mannosidase (EC 3.2.1.25)
 
Xanthomonas campestris pv. campestris str. ATCC 33913

Gene: XCC2891: Beta-mannosidase (EC 3.2.1.25)
 
Xylella fastidiosa 9a5c

Gene: XF0846: Beta-mannosidase (EC 3.2.1.25)
Beta-mannosidase (EC 3.2.1.25)
omp(Man)-2
*
Stenotrophomonas maltophilia K279a

Site:
position = -87
score = 3.96265
sequence = GTCTTGAACCGATCCAGGTG

Site:
position = -123
score = 5.42791
sequence = AGTTTGGATCGATCCACAGG

Gene: Smlt2175: Mannosides-regulated TonB-dependent outer membrane receptor
 
Xanthomonas axonopodis pv. citri str. 306
*
Xanthomonas campestris pv. campestris str. ATCC 33913

Site:
position = -92
score = 5.57672
sequence = GATTTGGATCGGTCCAAAGC

Gene: XCC4222: Mannosides-regulated TonB-dependent outer membrane receptor
 
Xylella fastidiosa 9a5c
Mannosides-regulated TonB-dependent outer membrane receptor
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD