Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog TreR - Thermoanaerobacterales

Properties
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Trehalose utilization
Effector: Trehalose
Phylum: Firmicutes
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 6 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Anaerocellum thermophilum DSM 6725
Caldicellulosiruptor saccharolyticus DSM 8903
Carboxydothermus hydrogenoformans Z-2901
Moorella thermoacetica ATCC 39073
Thermoanaerobacter ethanolicus X514 5 2
Thermoanaerobacter italicus Ab9 5 2
Thermoanaerobacter tengcongensis MB4 5 2
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
treF
 
Anaerocellum thermophilum DSM 6725
 
Caldicellulosiruptor saccharolyticus DSM 8903
 
Carboxydothermus hydrogenoformans Z-2901
 
Moorella thermoacetica ATCC 39073
*
Thermoanaerobacter ethanolicus X514

Site:
position = -74
score = 6.61324
sequence = AATTGTAAGCGCTTACAGTT

Gene: Teth514_2196: Predicted trehalose utilization ABC transporter, permease protein 1
*
Thermoanaerobacter italicus Ab9

Site:
position = -77
score = 6.20408
sequence = GATTGTAAGCGCTTACAGTT

Gene: Thit_0761: Predicted trehalose utilization ABC transporter, permease protein 1
*
Thermoanaerobacter tengcongensis MB4

Site:
position = -63
score = 6.08643
sequence = AACTGTAAGCGCTTTCAATA

Gene: TTE0804: Predicted trehalose utilization ABC transporter, permease protein 1
Predicted trehalose utilization ABC transporter, permease protein 1
treG
 
Anaerocellum thermophilum DSM 6725
 
Caldicellulosiruptor saccharolyticus DSM 8903
 
Carboxydothermus hydrogenoformans Z-2901
 
Moorella thermoacetica ATCC 39073
 
Thermoanaerobacter ethanolicus X514

Gene: Teth514_2195: Predicted trehalose utilization ABC transporter, permease protein 2
 
Thermoanaerobacter italicus Ab9

Gene: Thit_0762: Predicted trehalose utilization ABC transporter, permease protein 2
 
Thermoanaerobacter tengcongensis MB4

Gene: TTE0805: Predicted trehalose utilization ABC transporter, permease protein 2
Predicted trehalose utilization ABC transporter, permease protein 2
treE
 
Anaerocellum thermophilum DSM 6725
 
Caldicellulosiruptor saccharolyticus DSM 8903
 
Carboxydothermus hydrogenoformans Z-2901
 
Moorella thermoacetica ATCC 39073
 
Thermoanaerobacter ethanolicus X514

Gene: Teth514_2194: Predicted trehalose utilization ABC transporter, substrate-binding protein
 
Thermoanaerobacter italicus Ab9

Gene: Thit_0763: Predicted trehalose utilization ABC transporter, substrate-binding protein
 
Thermoanaerobacter tengcongensis MB4

Gene: TTE0806: Predicted trehalose utilization ABC transporter, substrate-binding protein
Predicted trehalose utilization ABC transporter, substrate-binding protein
treP
 
Anaerocellum thermophilum DSM 6725

Gene: Athe_0403: Trehalose phosphorylase (EC 2.4.1.64)
 
Caldicellulosiruptor saccharolyticus DSM 8903

Gene: Csac_0444: Trehalose phosphorylase (EC 2.4.1.64)
 
Carboxydothermus hydrogenoformans Z-2901
 
Moorella thermoacetica ATCC 39073
 
Thermoanaerobacter ethanolicus X514

Gene: Teth514_2193: Trehalose phosphorylase (EC 2.4.1.64)
 
Thermoanaerobacter italicus Ab9

Gene: Thit_0764: Trehalose phosphorylase (EC 2.4.1.64)
 
Thermoanaerobacter tengcongensis MB4

Gene: TTE0807: Trehalose phosphorylase (EC 2.4.1.64)
Trehalose phosphorylase (EC 2.4.1.64)
 
CRON 2.
treR
 
Anaerocellum thermophilum DSM 6725
 
Caldicellulosiruptor saccharolyticus DSM 8903
 
Carboxydothermus hydrogenoformans Z-2901
 
Moorella thermoacetica ATCC 39073
*
Thermoanaerobacter ethanolicus X514

Site:
position = -41
score = 7.14005
sequence = AACTGTAAGCGGTTACAGTA

Gene: Teth514_2197: Predicted trehalose utilization transcriptional regulator, LacI family
*
Thermoanaerobacter italicus Ab9

Site:
position = -41
score = 7.14005
sequence = AACTGTAAGCGGTTACAGTA

Gene: Thit_0760: Predicted trehalose utilization transcriptional regulator, LacI family
*
Thermoanaerobacter tengcongensis MB4

Site:
position = -41
score = 7.14005
sequence = AACTGTAAGCGGTTACAGTA

Gene: TTE0803: Predicted trehalose utilization transcriptional regulator, LacI family
Predicted trehalose utilization transcriptional regulator, LacI family
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD